Answer :<em> That trough time, a specie of animal, plant, bacteria can change.
</em>
<em>
</em>
<em>When a life form reproduces, one of its"babies" may be different from its parents because of genetic mutation. </em>
<em />
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
The cell wall of oomycetes, however, is not composed of chitin, as in the fungi, but is made up of a mix of cellulosic compounds and glycan. The nuclei within the filaments are diploid, with two sets of genetic information, not haploid as in the fungi.
Cells do need food. In a process known as cellular respiration, cells convert biochemical energy (oxygen as food) from nutrients into adenosine triphosphate (ATP), and then release waste products.
hope this helps.. :D
