Transcription factors are necessary for an initiation of transcription at a regulated gene but not sufficient.
Transcription is the first step of gene expression in which DNA molecule is copied (transcribed) into RNA (mRNA) by RNA polymerase. The process of transcription is divided into three phases:
1. Initiation
• RNA polymerase with transcriptional factors bind to gene promoter Transcription factors can enhance the interaction between RNA polymerase and a DNA sequence- promoter, encouraging the expression of the gene. Such transcription factors are called activators. Otherwise, when the gene expression is inhibited, factors are called repressors and they bind to sequence –operator.
• RNA polymerase unwinds DNA double helix (transcription bubble is formed)
2. Elongation
• RNA polymerases adds nucleotides complementary to DNA
3. Termination
• RNA polymerase gets to stop codon (transcribes a sequence of DNA known as a terminator)
• Formed complementary RNA strand is released from DNA-RNA complex
The anwser of d I’m sure of it
Answer:
The codon AUG, commonly known as the start codon, specifies the amino acid methionine. As a result, during protein synthesis, methionine is the first amino acid to dock in the ribosome.
<u>OAmalOHopeO</u>
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
