1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nata0808 [166]
3 years ago
7

The functions of which cell structure are described in this list?

Biology
1 answer:
yan [13]3 years ago
3 0

Answer:

Hey!

Wait... which list?

You might be interested in
If a net force of 24 Newton’s is applied on an object of mass 6 kilograms, what will be the acceleration of the object
madam [21]

Answer:

Explanation:

hello

5 0
2 years ago
Read 2 more answers
*****!!!! lots of points and brainliest!!!******** how do i find the codon and anti codon? :)​
pogonyaev

Answer:

The way to find a codon is by arranging the sequence of nitrogenous bases of the mRNA in groups of three, the triplets. Once the codon is found, the anticodon corresponds to a complementary triplet to that codon.

Explanation:

Codon corresponds to a triplet of mRNA nitrogen bases encoding an amino acid. Anticodon is responsible for carrying amino acids to the ribosome, according to the information of the mRNA, and the sequence of its triple must be complementary to that of the codon mRNA.

If, for example, a codon of the mRNA is AUG, its anticodon of the tRNA must be UAC, that is, complementary. Then, for the indicated exercises:

<u>Exercise 1:</u>

  • DNA    ATACGAAATCGCGATCGCGGCGATTCGG
  • mRNA    UAUGCUUUAGCGCUAGCGCCGCUAAGCC
  • CODON         UAU|GCU|UUA|GCG|CUA|GCG|CCG|CUA|AGC|C-
  • AntiCODON AUA|CGA|AAU|CGC|GAU|CGC|GGC|GAU|UCG|G-
  • Amino acid    Tyr|Ala|Leu|Ala|Leu|Ala|Pro|Leu|Ser

<u>Exercise 2: </u>

  • DNA    TTTACGGCCATCAGGCAATACTGG
  • mRNA    AAAUGCCGGUAGUCCGUUAUGACC
  • CODON         AAA|UGC|CGG|UAG|UCC|GUU|AUG|ACC
  • AntiCODON  UUU|ACG|GCC|AUC|AGG|CAA|UAC|UGG
  • Amino acid     Lys|Cys|Arg|Stop|Ser|Val|Met|Thr
3 0
3 years ago
Explain the lytic and lysogenis cycle in viruses.<br>​
astra-53 [7]

Answer:

<h3>The lytic cycle and the lysogenic cycle are means of viral replication. This takes place within the host cell and the virus takes control of the host cell and controls its cellular mechanism to reproduce itself.</h3>

4 0
3 years ago
High fever, nausea, diarrhea, dizziness, and rash are symptoms of
lions [1.4K]
<span>Toxic shock syndrome</span>
7 0
3 years ago
Read 2 more answers
Escherichia coli replicates in one plane and is a rod-shaped bacteria. it is a bacterium normally found in the intestine of huma
Lelu [443]
<span>False. E.coli is generally about 2 micrometers in size compared to white blood cells which are around 13 micrometers in size. Also, white blood cells have a characteristic segmented nucleus with two to five lobes joined by fine strands of chromatin.</span>
8 0
3 years ago
Other questions:
  • Based on the current understanding of this operon, which hypothesis would be useful for James to test?
    15·1 answer
  • Darby is taking a hike. She sees a pile of broken rocks near the base of a cliff. the area is a dangerous place for ____. glacie
    6·1 answer
  • Fill in the blanks....
    6·1 answer
  • DNA transcription and translation worksheet
    10·1 answer
  • Suppose the first nucleotide on a codon is adenine. What will the first nucleotide be on the corresponding anticodon?
    6·1 answer
  • Fill in the blanks to complete the passage.
    7·2 answers
  • The bolus is liquefied in the ______ and it is now called chyme.
    15·1 answer
  • ¿cómo afecta la escasez de alimento a una población ?​
    14·1 answer
  • What is the function of valves between the heart chambers?
    9·1 answer
  • What is the primary function of the light dependent reaction of photosynthesis
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!