The answer is; DNA
The central dogma is DNA- RNA- Protein
Gene therapy involves the replacement of bad genes in the DNA of a human subject with a better gene. A recessive/mutated allele is removed and a healthy one is inserted. This way, the proper proteins can be produced solving the disease trait. Ultimately, it will not require drugs to treat the disease.
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
The correct answer to this question is letter A. Speciation. <span>The Galapagos finch species are an excellent example of speciation. It was Charles Darwin himself who is responsible and made the start of the study in Genetics through his natural selection and survival of the fittest. Hope this helps answer your question.</span>
Answer:
It fuses with and becomes part of the plasma membrane.
Explanation:
Exocytosis -
Exocytosis is the process of expelling out the substances from the cell . It also helps in the cell transport and cell signalling process .
In this process a large amount of molecule are released and making it a form of the bulk transport .
In this process , the secretory vesicles are then carried to membrane of the cell and then their contents are secreted into the extracellular environment .
Answer:
Read It and Understand
Explanation:
There are over 200 different cell types in the human body. Each type of cells is specialised to carry out a particular function, either solely, but usually by forming a particular tissue. Different tissues then combine and form specific organs, where the organ is like a factory where every type of cell has its own job.
