1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Allisa [31]
3 years ago
10

Suppose different species of sea urchins release gametes into the ocean at the same time. The inability of sperm and egg cells o

f different species to unite and form a zygote due to structural differences is an example of
Biology
1 answer:
Mademuasel [1]3 years ago
8 0

Answer:

gametic isolation

Explanation:

You might be interested in
Damage to the ventromedial hypothalamus leads to:
Kamila [148]
Damage to the ventromedial hypothalamus leads to unusually frequent meals because the ventromedial hypothalamus (VMH) is the area of the brain that lets your body know you're full and to slow down your mouth glands and appetite. 
4 0
4 years ago
which of the following is an example of parasitism? a. clownfish defending sea anemone from other predators b. hookworms consumi
Sloan [31]
It is B, as one organism is benefiting, while the other is harmed
4 0
4 years ago
Read 2 more answers
What is water that is stored below the surface?
lana [24]
The answer is "Groundwater"
8 0
3 years ago
Which of the following types of mutation would convert a proto-oncogene into an oncogene?
Diano4ka-milaya [45]
I think the correct answer from the choices listed above is option A. The <span>type of mutation that would convert a proto-oncogene into an oncogene would be </span><span>a deletion of most of the proto-oncogene coding sequence. Hope this answers the question. Have a nice day.</span>
3 0
3 years ago
Paul is outside his grocery store protesting GMO foods not being labeled. What is a gmo food? Do you agree or disagree with Paul
Feliz [49]

Answer:

'Genetically modified organisms' are organisms which have been altered genetically using genetic engineering. Genetically modified foods should be labelled since they allow the user to understand and to give them the choice to either eat them or not.

Explanation:

<u>Genetic engineering</u> is the process by which GMO are produced. Genetic engineering allows changes to be made at genetic level where new sequences of genes are introduced or deleted though techniques like <em>selective breeding</em> or <em>mutation breeding</em>.

Certain advantages and disadvantages of genetically modified food are stated below:

  • In agriculture, crops are produced with better yield and taste.
  • The crops are also made resistant to pests and insects.
  • The seeds mature quickly.
  • Few examples of GM foods are Golden rice, Flavr savr tomatoes, Bt cotton, etc.

Disadvantages of GMO:

  • The new traits introduced can cause adverse <em>health reactions</em>.
  • If these resistant varieties cross breed they might result in production of 'super weeds'.

Foods must be labelled since there might be health issues caused by them. The nutritional value of the food might be changed which should be observed if it is to be given to infants.

5 0
3 years ago
Other questions:
  • Rank the following scientific questions from the general to the most narrowly focused question.   A. How do mountains form? B. H
    11·1 answer
  • Humans and baboons are each a type of what
    14·2 answers
  • Can someone tell me the answers.
    8·1 answer
  • The bacterial initiator tRNA is fMet-tRNAiMet whereas the eukaryotic initiator tRNA lacks the formyl group on the amino moeity;
    5·1 answer
  • which of the following is the heaviest and fastest of all the small wildcats is the _______. a. jaguar b. tiger c. caracal d. bo
    14·2 answers
  • The nurse is caring for a football player scheduled for ankle surgery. the patient communicates properly during the interview. t
    8·1 answer
  • Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
    6·1 answer
  • 56. You find bloody clothing at a crime scene and you want to send it back to the lab for testing, what
    6·2 answers
  • A sensor that monitors and responds to changes in the environment is called the..................
    11·1 answer
  • Which of the following is(are) not components of all cells?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!