1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natali [406]
3 years ago
13

Damage to the ventromedial hypothalamus leads to:

Biology
1 answer:
Kamila [148]3 years ago
4 0
Damage to the ventromedial hypothalamus leads to unusually frequent meals because the ventromedial hypothalamus (VMH) is the area of the brain that lets your body know you're full and to slow down your mouth glands and appetite. 
You might be interested in
Why can't prokaryotic species be defined as a group of similar organisms that could sexually reproduce together?
s344n2d4d5 [400]

Answer:

The prokaryote divides by asexual mode of reproduction.

Explanation:

The concept of species which defines a species as a group of individuals of a population which can interbred and produce a fertile progeny is applicable to the organism which can reproduce sexually.

Since the bacteria divide through asexual means and not through sexual ways therefore the concept of defining a species becomes complicated and does not apply.However the concept of species in prokaryotes is still a topic of research.  

Thus, the biological concept of species is not applicable to prokaryotes.

6 0
2 years ago
The tissue that covers and protects your body is your
Bas_tet [7]
The answer is most likely skin.
5 0
2 years ago
Read 2 more answers
When looking at the clouds, you can usually make out different shapes and figures with what?
andriy [413]
Your answer would be cumulus clouds.
4 0
2 years ago
During mitosis, which phase would be considered the opposite of prophase in terms of changes to the nucleus?
netineya [11]
1234567891011121314151617181920
7 0
3 years ago
Taking care of one's own body is called<br>​
marin [14]

Taking care of your body emotionally, physically, and mentally through creating joy and satisfaction is an important part of living with or without a mental health condition. Studies show that: Laughing decreases pain, may help your heart and lungs, promotes muscle relaxation, and can reduce anxiety.

4 0
2 years ago
Other questions:
  • As sales tax is s type of
    10·1 answer
  • What are synapomorphies
    9·1 answer
  • Some people who have narcolepsy experience a sudden loss of muscle tone, a condition called ________. This can be very dangerous
    13·1 answer
  • Which animal lives in the hydrosphere and lithosphere? eagle duck shark lizard
    15·1 answer
  • You pick one of the four
    9·1 answer
  • Which of the following structures collects the depolarization wave from the atria to pass it onto the ventricles?
    5·1 answer
  • How are all living things classified
    8·2 answers
  • Dress) write the process its raw material go through​
    10·1 answer
  • Which functional characteristics of proteins distinguishes them from carbohydrates
    13·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!