1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elenna [48]
2 years ago
13

Which is not a product of photosynthesis? oxygen nitrogen water glucose

Biology
1 answer:
3241004551 [841]2 years ago
7 0

<em><u>Nitrogen</u></em><em><u> </u></em><em><u>is</u></em><em><u> </u></em><em><u>not</u></em><em><u> </u></em><em><u>a</u></em><em><u> </u></em><em><u>product</u></em><em><u> </u></em><em><u>of</u></em><em><u> </u></em><em><u>photosynthesis</u></em>

You might be interested in
Note the following descriptions:
pogonyaev

The correct option is:

B) lipid

Explanation:

A lipid is a biomolecule that is solvable in nonpolar solvents. Non-polar solvents are typically hydrocarbons used to melt another naturally happening hydrocarbon is.Any of a large group of organic mixtures that are oily to the touch and difficult in water. Lipids comprise fatty acids, oils, waxes, sterols, and triglycerides. They are a source of stored energy and are an element of cell membranes.


8 0
3 years ago
Read 2 more answers
Give scenarios then give your interference and predictions.
sdas [7]

Answer:

interference

Explanation:

one of the best example of interference is demonstrated by the light reflected. from a flim of oil floating on water.

7 0
2 years ago
What is the relationship between ligaments, bones and joints?​
kakasveta [241]

Ligaments connect one bone to another bone. Therefore, they allow a joint to form, because joints are where two or more bones connect.

Take your knee joint for instance (***see attached pic***). The knee joint is formed by the connection of the femur (your thigh bone), the tibia (your shin bone), and the fibula (the other long bone in your lower leg). In order for all of these bones to connect there are many ligaments in the knee joint that keep the bones connected and in place.  A well known example of one of these ligaments in the knee joint is the ACL (anterior crucate ligament), which is commonly torn in sports, namely football. Most people have heard of this ligament because it receives a lot of media attention since tearing it can greatly alter or even end professional athletes' careers.

8 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
3 years ago
What is the main function of a nephron?
ExtremeBDS [4]
The main function of the nephron is to filter wastes out of the body and the re-absorption of substances required by the body.
The nephron also has components that have specific functions. There are about 1 million nephrons in one kidney
7 0
3 years ago
Read 2 more answers
Other questions:
  • Define crop rotation
    11·1 answer
  • An ordinary cell thunderstorm is a
    7·1 answer
  • Aquatic organisms are able to survive when the temperature decreases. These organisms survive even when the surfaces of lakes an
    13·1 answer
  • How does an observation of an object differ from an inference from that object?
    13·1 answer
  • What is a pheromone?
    8·2 answers
  • All of the squirrels, grass, oak trees, and turtles in a forest would be considered a
    8·2 answers
  • Why did Alfred hershey and Martha Chase choose to use bacteriophages in their research?
    6·2 answers
  • DNA strands run antiparallel which means?
    14·1 answer
  • If my pet dog fell ill i should take him to hospital ?true or false
    13·1 answer
  • The circulatory system help to maintain homeostasis by interacting with the
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!