1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lubasha [3.4K]
2 years ago
13

PLEASE HELP

Biology
1 answer:
LUCKY_DIMON [66]2 years ago
5 0

Answer: “The resident time would be zero because carbon is released as soon as it is absorbed”

Explanation: Just took the quick check :) and also “balanced” gave me a key word that nothing is unequal so the release of carbon and the carbon being absorbed can’t be unequal (decrease or increase) so I makes sense for it to be zero, the moment carbon is released is the moment it becomes absorbed. Not a great scientific explanation but that’s what I thought it as in this tiny brain of mines!

You might be interested in
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
PLZ HELP ME I NEED IT CAUSE I SUCK AT SCI!!! After a town is abandoned, the concrete parking lots remain empty and inactive for
Ugo [173]

Answer: B

Explanation:

Would be last, wouldn’t they? That would make the most sense to me.

6 0
2 years ago
Read 2 more answers
_____ is an area in the left frontal lobe of the brain that is involved in speech production
bogdanovich [222]
<span>BROCA'S AREA Broca's area or the Broca area is a region in the left frontal lobe of the dominant hemisphere of the hominid brain with functions linked to speech production. Broca area, also called convolution of Broca, region of the brain that contains neurons involved in speech function. This was discovered in 1861 by French surgeon Paul Broca, who found that it serves a vital role in the generation of articulate speech.</span>
5 0
3 years ago
the muscular system and the skeletal system are two different organ systems, but they’re often referred to jointly as the muscul
Lana71 [14]
The muscular system is responsible for the movement of the human body. Attached to the bones of the skeletal system are about 700 named muscles that make up roughly half of a person's body weight. Each of these muscles is a discrete organ constructed of skeletal muscle tissue, blood vessels, tendons, and nerves.
7 0
3 years ago
Read 2 more answers
What does the prefix "hetero-" mean?<br>A. Same<br><br>B. Different
disa [49]
I would say different
Like you like different genders
4 0
3 years ago
Read 2 more answers
Other questions:
  • Where did the following drugs originate from?
    5·1 answer
  • On most bicycles, the tires include a separate inner tube inside the tire itself. when the inner tube is inflated, often to pres
    14·1 answer
  • Carotenoids are often found in foods that are considered to have antioxidant properties in human nutrition. What related functio
    9·1 answer
  • How does mountains deposit?
    15·1 answer
  • Please help ☁ ☂
    9·2 answers
  • What is the function of a negative regulator gene
    6·1 answer
  • Sorry that you can’t really read that. The last work is surface wave. Please help
    5·1 answer
  • Density of a hurricane
    11·1 answer
  • What are the 3 difference between DNA and RNA
    9·2 answers
  • What is an example of mitosis at work is a leaf?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!