1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ZanzabumX [31]
2 years ago
13

Which forest biome has year-round

Biology
1 answer:
riadik2000 [5.3K]2 years ago
7 0

Answer:

Due to their global position, temperate forests generally receive about 75-150 cm of precipitation every year.

Explanation:

(That's a lot, second only to the Tropics).

You might be interested in
¿Qué sucedería si por una epidemia desaparecieran las golondrinas marinas?
tamaranim1 [39]

Answer:

27-May-2019 · 1 answer

ludys88 está esperando tu ayuda. Añade tu respuesta y gana puntos. Respuesta. 4.4/5. 52. ke7vi. Aspirante. 8 respuestas. 614 personas ayudadas. Respuesta: aumentarían las 

3 0
2 years ago
Whats 5 plus 372831-
egoroff_w [7]

Answer:

372836

Explanation:

just use your brain do you know how to add?

4 0
3 years ago
The relationship between the number of organisms in the food chain and the size of the individual organisms within each level of
olganol [36]
<span>The relationship between the number of organisms in the food chain and the size of the individual organisms within each level of the food chain is
</span><span>


d) inversely proportional
</span>
6 0
3 years ago
Read 2 more answers
Use the terms in the answers below to fill in the blanks in the following sentences. "An investigator is studying mutants in met
Arlecino [84]

Question is incomplete i have added full question in ask for detail section.

Answer:

Option a. met3, Met3p, MET3 is correct answer

"An investigator is studying mutants in methionine synthesis. The _met3_ mutants are unable to ATP sulfurylase, also known as _Met3p_. This protein is the product of the _MET3_gene. "

Explanation:

MET3 encodes ATP sulfurylase, which is a catalyst of first step of the sulfur assimilation pathway. This pathway results in the formation of hydrogen sulfide which is  a precursor in the biosynthesis of  cysteine, homocysteine, and methionine.

Source: National Center for Biotechnology Information, U.S. National Library of Medicine

3 0
2 years ago
Protected health information includes all medical information that
Anna11 [10]
Protected health information includes all medical information that an individual can be identified provided by:transmitted by electronic media, maintained in electronic media and transmitted or maintained in any form or medium (paper and oral communication).
3 0
3 years ago
Other questions:
  • What subatomic particles make up an atom’s mass number
    9·1 answer
  • in figure 34-1 structure F produces which of the following hormones when you're feeling stress about a big test
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • How do you find quotation 
    7·1 answer
  • Chemosynthesis _______. Question 11 options: uses energy derived from hydrocarbons and hydrogen sulfide in place of solar energy
    13·1 answer
  • A plastic bottle contains 32.5 L of gas at a pressure of 45.7 kPa and
    5·1 answer
  • Plz help will mark brainliest
    11·2 answers
  • A hurricane passes through the Gulf of Mexico and destroys many of the coastal regions of Northwest Florida. Which of the follow
    5·1 answer
  • Rocks are classified as igneous, metamorphic, or sedimentary according to?
    5·2 answers
  • Is natural selection the only means of evolution? Explain.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!