1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sesenic [268]
2 years ago
15

Is the origin a solution to the system graphed?

Mathematics
1 answer:
lapo4ka [179]2 years ago
4 0

Answer:

No

Step-by-step explanation:

I do not believe the origin is a solution.

-> While the blue shaded portion does cover the origin, it is a dashed line meaning that the values on the line are not within the solution to the system graphed

Have a nice day!

     I hope this is what you are looking for, but if not - comment! I will edit and update my answer accordingly. (ノ^∇^)

- Heather

You might be interested in
The numbers of pages in the books in a library follow a normal distribution. If the mean number of pages is 180 and the standard
laiz [17]

Answer:

option B.

About 16% of the books have fewer than 150 pages

Step-by-step explanation:

Since we are dealing with a normal distribution

68.27% of the values will fall in the range with the standard deviation

(180-30 , 180+30) = (150, 210)

Approximately 15.86% of the values will be higher than 210

and the rest 15.86% will be lower than 150

So the correct answer is option B.

About 16% of the books have fewer than 150 pages

4 0
3 years ago
Trapezoid ABCD is shown below.
notka56 [123]

Answer:

A III only

Step-by-step explanation:

Because it's the answer and also when you do 3 x 3 and divide it by 3 you will get 3 that's why it's A.) III only

7 0
3 years ago
Write the expression in radical form.
Effectus [21]
I think it would be B
6 0
3 years ago
Read 2 more answers
The area of a rectangle is represented by x^2-5c-14. What are the dimensions?
jekas [21]
The dimensions are factors of the expression 
... you multiply them together to get the area 

the factors are ... (x - 7) & (x + 2)
5 0
3 years ago
When we toss a coin, there are two possible outcomes: a head or a tail. Suppose that we toss a coin 100 times. Estimate the appr
marin [14]

Answer:

96.42% probability that the number of tails is between 40 and 60.

Step-by-step explanation:

I am going to use the binomial approximation to the normal to solve this question.

Binomial probability distribution

Probability of exactly x sucesses on n repeated trials, with p probability.

Can be approximated to a normal distribution, using the expected value and the standard deviation.

The expected value of the binomial distribution is:

E(X) = np

The standard deviation of the binomial distribution is:

\sqrt{V(X)} = \sqrt{np(1-p)}

Normal probability distribution

Problems of normally distributed samples can be solved using the z-score formula.

In a set with mean \mu and standard deviation \sigma, the zscore of a measure X is given by:

Z = \frac{X - \mu}{\sigma}

The Z-score measures how many standard deviations the measure is from the mean. After finding the Z-score, we look at the z-score table and find the p-value associated with this z-score. This p-value is the probability that the value of the measure is smaller than X, that is, the percentile of X. Subtracting 1 by the pvalue, we get the probability that the value of the measure is greater than X.

When we are approximating a binomial distribution to a normal one, we have that \mu = E(X), \sigma = \sqrt{V(X)}.

In this problem, we have that:

100 tosses, so n = 100

Two outcomes, both equally as likely. So p = \frac{1}{2} = 0.5

So

E(X) = np = 100*0.5 = 50

\sqrt{V(X)} = \sqrt{np(1-p)} = \sqrt{100*0.5*0.5} = 5

Estimate the approximate probability that the number of tails is between 40 and 60.

Using continuity correction.

P(40 - 0.5 \leq X \leq 60 + 0.5) = P(39.5 \leq X \leq 60.5)

This is the pvalue of Z when X = 60.5 subtracted by the pvalue of Z when X = 39.5. So

X = 60.5

Z = \frac{X - \mu}{\sigma}

Z = \frac{60.5 - 50}{5}

Z = 2.1

Z = 2.1 has a pvalue of 0.9821

X = 39.5

Z = \frac{X - \mu}{\sigma}

Z = \frac{39.5 - 50}{5}

Z = -2.1

Z = -2.1 has a pvalue of 0.0179

0.9821 - 0.0179 = 0.9642

96.42% probability that the number of tails is between 40 and 60.

8 0
3 years ago
Other questions:
  • + 10<br>The perimeter of a square is 60cm.<br>Work out the area of the square,<br>cm2​
    14·2 answers
  • Human blood it is 8% proteins. write the ratio of proteins to other components.
    14·1 answer
  • What is the area of this figure?
    10·2 answers
  • Mr.Ramirez divides 12 frogs equally into 6 groups for students to study.how many frogs are in each group?Label known and unknown
    14·2 answers
  • Name three solutions of x &gt; 10.5
    9·1 answer
  • The cost of a renting premises is 90% of the total costs of a company. The rental price was reduced 6 times, ceteris parabus. Wh
    6·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • What is the square root of 134
    7·2 answers
  • Simone travels 90 miles at an average speed of 40 mph.
    7·1 answer
  • A card is chosen at random from a standard deck.
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!