1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lilit [14]
3 years ago
5

what is true of atoms in terms of being natural. negatively charged, and positively charged is also true for objects. An object

that is negatively charged must have A. less B. more C. the same number of
Biology
1 answer:
Ket [755]3 years ago
4 0

Answer:

A

Explanation:

The protons are positively charged, the electrons are negatively charged, and the neutrons are neutral. Therefore, all things are made up of charges. Opposite charges attract each other (negative to positive). Like charges repel each other (positive to positive or negative to negative

You might be interested in
What does pH measure?
kogti [31]

Answer: Answer below

Explanation: pH is a measure  of the acidity or alkalinity of a solution. What the pH scale measures is basically the concentration of hydrogen and hydroxyl atoms in a solution. So, the last option is the answer. Another thing to keep in mind is solutions with a pH under 7 are acidic, solutions with a pH of 7 are neutral, and solutions with a pH over 7 are alkaline or considered a base. I hope this helped! Good luck:)

7 0
3 years ago
Respiration and photosynthesis both add carbon dioxide to the atmosphere.
Crank

Answer: false

Explanation: photosynthesis takes carbon dioxide and releases oxygen

8 0
3 years ago
Read 2 more answers
George has several plants in his garden. Once in a while, he adds fertilizer to the soil. The leaves absorb the nutrients in the
olganol [36]
The correct answer would be C. vacuole. The organelle that helps transport fertilizer from the soil to the leaf would be the vacuole because it can store bubbles, food, or waste.
8 0
3 years ago
if a parent with A blood type has an offspring with someone who has A blood, what are the chances of the offspring having A bloo
Flura [38]
I'm pretty sure it's 90%
5 0
4 years ago
Read 2 more answers
Will Mark Brainliest, PLS HELP!
dusya [7]

Answer:

Lactic Acid Fermentation!

Explanation:

I am So sorry If I'm Wrong! But I Hope I Helped.

8 0
3 years ago
Other questions:
  • The kidneys secrete an enzyme called ____________ that aids in the regulation of blood pressure
    10·2 answers
  • Check all possible effects of this selective pressure. Flock X may try to eat other foods. Flock X could migrate in search of fr
    15·2 answers
  • _______ are responsible for converting sensory messages into neural impulses.
    10·2 answers
  • What helps keep the temperature of living things
    9·1 answer
  • What is the effect of alcohol on the skills and abilities needed to hunt safely and responsibly?
    7·2 answers
  • The layers of earth from the center are the
    14·2 answers
  • What insect/animal improves the fertility of soil by breaking down once-living matter and aerating soil?
    8·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • Which question could be tested in a scientific manner?
    5·1 answer
  • Which abiotic component of its ecosystem did the owl in the picture above use to build a safe nest?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!