1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dennis_Churaev [7]
2 years ago
5

1. Why is cell an open dynamic system?​

Biology
1 answer:
Inga [223]2 years ago
5 0

The exchange of matter or substances between the cell and its environment is dynamic as it varies in direction and rate as per the requirements of the cell. Thus,a cell attains a stead -state wherein the internal conditions of the cell remain constant. Hence, cell is considered to be a open dynamic system

You might be interested in
The fact that cats and humans are both classified as mammals provides us with which minimum of information?
Aleks04 [339]

Answer:

a. option :both have mammary glands is the correct answer right no

5 0
2 years ago
Which of these is a function of the xylem?
Aleksandr-060686 [28]
The xylem is the structure of the plant that is responsible for transporting water from the ground up to the different parts of the plant. It is composed water, inorganic ions, and a number of organic chemicals.  
<span>
Xylem tissue is found throughout the plant because not only does it transport water, but it also transports the nutrients that the plant needs for different processes. Aside from being responsible for the transportation of materials, the xylem is also used to replace water that was lost during photosynthesis and transpiration. </span>
5 0
3 years ago
What is the role of tRNA during translation?
Anika [276]

Answer:

B. It provides the code for the protein

Explanation:

3 0
2 years ago
Read 2 more answers
Arguments FOR GMOs? Arguments AGAINST GMOs?<br>​
stich3 [128]

❤️Hello!❤️ In my opinion, i'm against GMO's. First of all you need to understand what GMO stands for, GMO means (Genetically Modified Organisms) and does that REALLY sound appealing to eat (Be honest). So now we have that covered i'm going to tell you some reasons why YOU should avoid Genetically Modified Organisms (GMO's). First of all GMO's are unhealthy, according to the American Academy of Environmental Medicine. They cite animal studies showing organ damage, gastrointestinal and immune system disorders, accelerated aging, and infertility. Second of all, GMO's contaminate forever. GMO's cross pollinate and their seeds can travel. It is impossible to fully clean up our contaminated gene pool. Self propagating GMO pollution will outlast the effects of global warming and nuclear waste. The impact is huge, threatening the health of future generations. Third of all, GMO's increase herbicide use, most GMO crops are engineered to be “Herbicide tolerant”―they deadly weed killer. Monsanto, for example, sells Roundup Ready crops, designed to survive applications of their Roundup herbicide.  Between 1996 and 2008, US farmers sprayed an extra 383 million pounds of herbicide on GMO's. Overuse of Roundup results in “superweeds,” resistant to the herbicide. This is causing farmers to use even more toxic herbicides every year. ♒️ Hope this helps!♒️  ↪️ Autumn ↩️

3 0
2 years ago
What five criteria must be met for a substance to be a mineral.
mafiozo [28]

Minerals may be defined as the combination of two or more elements of a substance.

<u>Five criteria that exhibits a particle to be minerals; </u>

  • They are natural and not man-made.
  • Inorganic i.e. not made by any organism.
  • Minerals are solids, not liquid or gas.
  • They have a definite chemical structure.
  • The atoms in minerals are arranged systematically and are arranged in a repeated pattern.

Minerals are natural and we use it in our day to day life. Products like salt and even a pencil have minerals. Also, these minerals help the parts in the human body to grow faster and function properly.

8 0
3 years ago
Other questions:
  • How does organic material enter soil
    8·2 answers
  • Your science teacher has asked the class to make a cell city model. Which building or business in the city could represent the m
    6·2 answers
  • Which bone tissue is found more on the inside (interior) of bone and very poreous (lots of holes)?
    14·1 answer
  • What types of bonds is broken when the dna becomes unzipped
    8·1 answer
  • Which of the following explains why cells differentiate?
    14·2 answers
  • How do enzymes impact a chemical reaction?
    12·1 answer
  • What is the typical structure of a long bone?
    10·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • How are the chromosomes different in the cancer cells compared to normal cells?
    5·1 answer
  • In meiosis, how does prophase i differ from prophase ii?.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!