1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Likurg_2 [28]
3 years ago
9

Do Bacteria and Viruses Work together in the human body?

Health
1 answer:
Amanda [17]3 years ago
3 0
They can work together, depending on the virus/bacteria.
You might be interested in
During a game of badminton, when returning your opponent's shot, the shuttle gets caught in the net. What happens next?
kirza4 [7]

Answer:

A point counts for the opponent

Explanation:

5 0
3 years ago
An active student injured his knee playing basketball and has been advised by his doctor to avoid impact activities that cause h
Andrew [12]
Swimming because it exerts no pressure on the joints
7 0
4 years ago
Read 2 more answers
Pleasssseee need answers
IRISSAK [1]
For the junk food question junk food and alcohol/drugs are similar because they are both addicting for example when u want to eat junk food like a candy or mcdonald’s you kinda crave for more or want to eat it again that’s how drugs/and alcohol are like
6 0
3 years ago
Read 2 more answers
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
3 years ago
A registered nurse teaches a nursing student about the effects of aspirin in pregnant women. Which statement made by the nursing
son4ous [18]

Answer:

The correction option is B: aspirin may cause reye syndrome

Explanation:

Aspirin is not a recommended drug to take when one is pregnant except there are certain medical conditions that warrants that. Higher doses of aspirin has been associated with risk of bleeding in the infant's brain. If however taken moderately (81 mg), it can act as a pain reliever which may suppress contractions during labor. It also acts against feverish conditions.

8 0
3 years ago
Other questions:
  • Which of the following can you do to reduce your risk for cardiovascular disease?
    12·1 answer
  • What is the ability to bounce back from setbacks or disappointments?
    7·2 answers
  • What is a pollutant that is measured by the air quality index?
    9·1 answer
  • How many liters of blood does an adult heart pump every minute of every day? 2 5 10 15
    6·2 answers
  • The class of nutrient that is necessary for production of certain hormones and that forms a coating on nerves is
    13·1 answer
  • Ma bace imn soa sdrunc
    13·1 answer
  • Which statement will most effectively communicate your refusal?
    14·2 answers
  • What are the terms for this.
    15·2 answers
  • How to manage Interpersonal Violence?
    9·1 answer
  • What type of carbs do you get from whole grains? <br> complete, simple, or complex
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!