1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
igomit [66]
2 years ago
12

cells in the nervous system which have various functions related to support and nourishment are called:

Biology
1 answer:
Marina CMI [18]2 years ago
4 0

brain or nervous system cells are called as neurons

You might be interested in
Specialized cells called. <br> cells help move the skeleton and help the heart beat and pump blood.
Novosadov [1.4K]

Answer:

pacemaker cells.

Explanation:

Cardiac muscle tissue works to keep your heart pumping through involuntary movements. This is one feature that differentiates it from skeletal muscle tissue, which you can control. It does this through specialized cells called pacemaker cells.

6 0
3 years ago
Read 2 more answers
Plz help meeeeeeeeee​
saveliy_v [14]

Answer:single replacemt

Explanation:

5 0
3 years ago
What strategies will a nurse include when planning an educational program for adults that ensures student learning?
Serga [27]
Some strategies can be outlining concepts, role playing, games,
8 0
3 years ago
It has been observed that certain species of insects which had not previously caused significant harm have become serious pests.
bulgar [2K]
What do you mean <span>It has been observed that certain species of insects which had not previously caused significant harm have become serious pests. the best explanation for this phenomenon is that the pesticide killed off predators which had previously held this species in check. a mutation occurred in the species. the pesticide increased the vigor of the species. was able to be used by the pest as an additional food source is also a reproductive for some insect species. </span><span />
7 0
3 years ago
The plant kingdom is divided into 2 groups vascular and nonvascular. describe each subclass. include key words such as vascular
BaLLatris [955]
<h2>Vascular and Nonvascular Plants </h2>

Explanation:

Kingdom Plantae on the basis of vasculature is divided into two groups-vascular and non-vascular plants .

  • <u>Vascular plants </u>or tracheophytes have a proper tissue-level organization and true shoot and root structures like leaves, stem, flowers, root etc
  • The tissue system or vasculature of vascular plants compromises of vascular tissues like tubular vessels – xylem and phloem
  1. The xylem transports nutrients to various parts of the body from the leaves.
  2. Phloem conducts water and other nutrients from the roots to various parts of the plant .
  • These are flowering plants that include the phanerogams – angiosperms and gymnosperms and bears flowers and fruits like the cedars, pine, clubmosses, lilies, sunflower etc.
  • Dicots are with tubular vasculature.  
  • Non-vascular plants or bryophytes with an absence of proper tissue-level organization and true shoot or root systems
  • <u>Nonvascular plants</u> are small. Their transport mechanism is poor due to lack of vascular tissues
  • These plants are lack proper shoot or root system.
  • It includes mosses, hornworts etc.
  • Monocots are plants with scattered tube-like vessels .
3 0
3 years ago
Other questions:
  • The simple pathway of communication from sensory neurons through interneurons in the spinal cord back out through motor neurons
    8·1 answer
  • Digitalized info can be used by computers true or false
    12·1 answer
  • The majority of human cancers are caused by ______.
    10·2 answers
  • The first eukaryotes were undoubtedly
    12·2 answers
  • What happens to an enzyme’s structure as it exceeds the typical human body temperature?
    8·1 answer
  • Sickle cell disease-homozygous dominant contract malaria; homozygous recessive die young from sickle cell; herterozygotes immune
    12·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • How are shapes and volume used to classify solids, liquids, and gasses?
    9·2 answers
  • In a crime scene, what would you place clothing with blood on it in found as evidence? And why?
    9·1 answer
  • Evidence of evolution
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!