1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Harman [31]
3 years ago
6

Can someone please help me with this question

Biology
1 answer:
Ivenika [448]3 years ago
5 0

Answer:

i think it D

Explanation:

hope it help if not sorry for the wrong answer

You might be interested in
an animals internal body structures can either be coelomate aceolmate or pseudocoelomate this means they may or may not have
Lera25 [3.4K]

They may not have a body cavity

4 0
3 years ago
The final product of the Calvin cycle is <br> A) RuPB <br> B) PGA <br> C) ATP <br> D) G3P
damaskus [11]
I'm sure that the answer is B
8 0
3 years ago
This is the electron carrier in cellular respiration.
anygoal [31]
The answer is the nad
7 0
3 years ago
Read 2 more answers
Which of the following is NOT true of carbohydrate absorption? a. End products of carbohydrate digestion are transported through
bulgar [2K]

Answer:

D. Lactose is absorbed intact and transported through the portal vein to the liver.

Explanation:

Lactose is a disaccharide. It is a sugar composed of galactose and glucose subunits and has the molecular formula C₁₂H₂₂O₁₁. Lactose as a disaccharide can never be absorbed just like that. It needs to be broken down into monosaccharides first.

3 0
3 years ago
Read 2 more answers
Cells function together to form tissues. The four main types of tissues in animals are.
Katyanochek1 [597]

Answer:

4.4 Animal tissues (ESG6H) Animal cells with the same structure and function are grouped together to form tissues. There are four types of animal tissues: epithelial tissue, connective tissue, muscle tissue and nervous tissue.

Explanation:

4 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which type of reproduction involves both parents?
    9·2 answers
  • The law of conservation of momentum states that the total momentum of a system _____.
    15·1 answer
  • Which circulatory disorder indicates an underlying coronary artery condition?
    5·1 answer
  • Would vision and audition be considered "higher senses” in non-human animals? Why or why not?
    15·1 answer
  • Luminous objects such as flashlights emit light that we can see. How do we see an object that isn’t luminous?
    14·2 answers
  • When reading a food label you discover your favorite ice cream has 12 grams of fat per serving and 240 calories. Approximately w
    5·1 answer
  • What is the main difference between food chains and food webs? (1 point)
    6·2 answers
  • How does farming affect biodiversity
    11·1 answer
  • Suppose scientists want to determine if the replacement of native forests with coconut palms has an effect on carbon dioxide con
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!