1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lemur [1.5K]
3 years ago
6

Describe Hydrogen Bonding. BEST ANSWER GETS BRAINLIEST

Biology
1 answer:
Leto [7]3 years ago
7 0

Hydrogen bonding is a interaction between two hydrogen atoms that is very essential for life on Earth. It is notoriously seen between water molecules, and it occurs when there is a slight disbalance in electrical charge between two Hydrogen atoms, and Oxygen atom that comprise water.  This slight imbalance makes the Oxygen slightly more electronegative, and the two hydrogen atoms slightly more electropostive.  The reason why water when spilled forms globules for this exact reasoning. The slightly positive charged hydrogen feels an electrostatic attraction to the Oxygen atom thus forming a strong bond. An interesting fact that comes from this electrical disbalance is that when salt is added to water, water is able to conduct electricity because of this disbalance in charge it can seperate the sodium chloride lattices into ions.

You might be interested in
Earth’s first life forms were __________. aerobic cyanobacteria photosynthetic chemoautotrophs
SCORPION-xisa [38]
Photosynthetic is the correct answer,
4 0
3 years ago
Read 2 more answers
Non-living factors in an ecosystem are
Usimov [2.4K]

non-living factors in an ecosystem are things that are not alive. like so rocks, water, air, soil and sunlight.

5 0
3 years ago
Read 2 more answers
What is the goal of artificial selection?
olya-2409 [2.1K]

Answer:

increase the productive or esthetic value of an organism to our

Explanation: Artificial selection aims to increase the productive or esthetic value of an organism to our advantage. In the field of biology, artificial selection covers a whole host of subtopics. One can implement artificial selection to eradicate disease, increase yield per acre, lower competition within an ecosystem, or produce a new color in a breed of dog.

3 0
2 years ago
(True or False)The chromosomes of plants usually occur in pairs
ale4655 [162]
True hope this helps
7 0
3 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Other questions:
  • Describe why you don't look like an elephant
    5·1 answer
  • What source of energy typically starts all food chains?
    8·1 answer
  • Which word describes the manner in which grendel enters heorot?
    13·1 answer
  • If a chemical reaction catalyzed by an enzyme is being carried out, and there is a sudden, drastic decrease in temperature, what
    13·2 answers
  • Which characteristic of the prokaryotic organisms makes them different from eukaryotes
    9·1 answer
  • Give Reasons<br>why addation of<br>acid<br>to a DNA solution causes a change<br>in its absorbance.​
    5·1 answer
  • Which do you think is more important? - nature (genes) or nurture (environment)
    15·1 answer
  • Which part of the mollusk body is specialized for burrowing,feeding , and movement
    6·1 answer
  • Explain the effects on anaerobic respiration on plants and animals​
    13·1 answer
  • There are seven possible processes. how many processes do you think your rock material will go through?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!