1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Free_Kalibri [48]
3 years ago
11

A drive is a(n) __________ stimulus that motivates behavior, whereas an incentive is a(n) __________ stimulus that motivates beh

avior. Tension-provoking. . . Tension-relieving external. . . Internal tension-relieving. . . Tension-provoking internal. . . External.
Biology
2 answers:
Varvara68 [4.7K]3 years ago
8 0

Answer:

Answer is D

Explanation:

EDGE2022

slavikrds [6]3 years ago
6 0

Drive-in motivation theory refers to the actions or activities carried out by people to reduce the stress caused by unmet needs.

The correct statements for the blanks are:

  • internal
  • external

A drive is an <u>internal </u>stimulus, which motivates the behavior of an individual. The internal stimulus comes from self-motivation or self-driven conditions. The drive is the internal stimulus that motivates an individual to reach a particular goal.

An incentive is an <u>external </u>stimulus, which motivates the behavior. earning money or gaining rewards can direct an individual to gain the goals and motivate them to sate the drive. It is an example of an external reward that motivates behavior in an individual.

Thus, the correct answers are internal and external.

To know more about motivation, refer to the following link:

brainly.com/question/972761

You might be interested in
Which of the following molecules does NOT contain a B-1,4 glycosidic linkage?
Lesechka [4]

Answer:

Chitin, Cellulose and Peptidoglycan (B, C and D)

Explanation:

Both chitin and cellulose are composed mainly of glucides, bound by glycosidic bonds of the Beta 1-4 type. This is largely why they cannot be digested by most non-herbivorous animals.

As for peptidoglycans, it is a net. It is a molecular framework present in bacteria that has β1-4 and α1-4 bonds in different proportions.

5 0
3 years ago
The visceral motor division of the PNS is also called the autonomic division. Which of the following are functions of this divis
Likurg_2 [28]

Answer:

Muscles

Explanation:

Muscles

4 0
3 years ago
Read 2 more answers
Pls, I need help with this! Biology Thank you :)
topjm [15]

Answer:

If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG

If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG

Explanation:

8 0
3 years ago
Pls helpppp and thank youuuu
Elena L [17]
I think the answer is C, it’s helps
4 0
3 years ago
An axon is a. a layer of fatty tissue that encases the fibers of many neurons. b. the extension of a neuron that carries message
Sati [7]

Answer:

option b the extension of a neuron that carries messages away from the cell body

3 0
3 years ago
Other questions:
  • Drug-resistant populations of microbes arise when
    10·1 answer
  • -=≡&gt;(100 Points And Brainlyest)&lt;≡=-
    12·1 answer
  • From which plexus does the highlighted nerve arise?
    12·1 answer
  • In 2002, Trask et al. published a study showing that a high frequency of HIV transmissions in Lusaka, Zambia occurred between ma
    8·1 answer
  • Which statement is the first step of protein synthesis?(1 point) A ribosome attaches to the mRNA. DNA unzips between the base pa
    6·1 answer
  • Fish respiratory systems exchange gas and receive oxygen at the gills. This oxygen then enters the bloodstream and is pumped thr
    12·1 answer
  • One difference between prokaryotic cells and eukaryotic cells is that
    15·1 answer
  • The following table lists the number and variety of organisms in
    5·1 answer
  • A cloud of dust and gas in space were stars are formed is a _____ .
    12·1 answer
  • The population of humans living on the Earth has increased tremendously due to scientific discoveries and technology. Which
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!