1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
levacccp [35]
3 years ago
12

Sally and Charlie were learning about the plant and animal kingdoms in science class. Their assignment for the day can be seen a

bove. Charlie said that BOTH plants and animals need sunlight and nutrients and they both make their own food. Sally said Charlie was wrong! She said that plants use sunlight to make their own food and animals eat their food. Who is correct? Explain using the three terms sunlight, nutrients, food. A) Sally is correct. Only plants need nutrients, and plants need sunlight to make their own food. Animals eat plants and other animals for food. B) Charlie is correct. Plants and animals need sunlight to live. They both make their own food and get the nutrients they need from the food. C) Charlie is correct. Plants and animals need sunlight and nutrients to survive. They both use the sunlight to make the food that they eat and the food provides nutrient. D) Sally is correct. All living things need nutrients. How they get them is different. Plants use sunlight to help them make their food. Animals eat food; they do not make food.
Biology
1 answer:
Tatiana [17]3 years ago
8 0

Answer:the answer is D

Explanation:

ALL LIVING THING NEEDS NUTRIENCE

You might be interested in
Jordan is doing a science fair project on the effects of music on the growth of tomatoes. He has two tomato plants, Plant A and
GREYUIT [131]
An expiremental constant is the amount of water and sunlight, the variable is the music
8 0
3 years ago
Read 2 more answers
What relationship between both an abiotic and a biotic factor in a ecosystem?
likoan [24]

Answer:

Abiotic factors are all of the non-living things in an ecosystem. Both biotic and abiotic factors are related to each other in an ecosystem, and if one factor is changed or removed, it can affect the entire ecosystem. Abiotic factors are especially important because they directly affect how organisms survive.

3 0
3 years ago
Read 2 more answers
Through the digestion system, water is mainly absorbed in the A. gallbladder. B. stomach. C. large intestine. D. small intestine
bogdanovich [222]
I would say D. small intestine

If you want an explanation, here it is

After leaving the stomach, water is absorbed mostly in the early segments of the
small intestine, the duodenum, and the jejunum. A small portion of all water absorption occurs in the stomach and the colon: the small intestine absorbs 6.5L/day, whereas the colon absorbs 1.3L/day.
5 0
3 years ago
Read 2 more answers
The water cycle consists of some water evaporating from the surfaces of bodies of water and going into the air. As result of air
damaskus [11]
Tight hydrogen bonding

The atoms in a compound are held together by a chemical bond. The chemical bonds can be either covalent bonds or ionic bonds. Both the bonds are considered very strong bonds. These bonds are mainly formed by sharing of electrons or in the case when one of the elements making the compound donates electron to the other element. The nucleus of each atom attracts to form a strong bond. This property of attraction between the nucleus of the atoms actually helps in forming the chemical bonds.<span>
</span>
7 0
3 years ago
Read 2 more answers
Based on the experiment in the scenario, which visual aid would be most helpful in showing the change in plants’ height overtime
Ahat [919]

Answer:

Option C, Bar graph

Explanation:

A bar graph is used to graphically represent a comparative data set where data belonging to different categories is presented.  

Here the different categories shall consists of  "different environment exposure" given to plant and under all the “exposed environmental condition” the growth of plant is compared. The categories can be kept on both horizontal and vertical axis of the graph.

Thus, a bar graph (either vertical or horizontal) would be the best to present this data set.

7 0
3 years ago
Other questions:
  • PLEASE HELP!!!!!
    8·2 answers
  • Which product comes from plants?
    11·1 answer
  • Which of the following is a good scientific hypothesis? Gasoline is made up of particles that can not be seen. If a plant is giv
    12·1 answer
  • Which type of mutation results in the formation of a protein is one incorrect amino acid
    11·2 answers
  • Which of the following is true regarding extinction?
    9·2 answers
  • Which statement best describes the role of the cell membrane?
    8·2 answers
  • Which inner planet is the largest?
    13·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What happens in people that have this difference in their DNA?
    10·1 answer
  • Type the correct answer in the box. Spell all words correctly.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!