Answer:
The physical properties of matter can be measured precisely using tools, such as a triple beam balance, a graduated cylinder or beaker, a metric ruler, timing devices, or a thermometer.
No one knows. There's no confirmation date at the moment. As that comment said, only time will tell.
Peregrine falcons have a wide diet, including many types of smaller birds. These birds eat bugs like grasshoppers. So, if the grasshopper population decreases, then the birds who are a food source to peregrine falcons will also have a lower population. This means that there is a lesser amount of food for the peregrine falcons to eat, so their population will decrease as well.
Good luck with your problems!
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
