Answer:
Transition
Explanation:
Secondary succession occurs when the existing vegetation is removed by some disturbances and soil is already present in the region to support the growth of new species. During succession, the early species are being replaced by later successional species.
In the given example, the forest has patches of early species and later species. This means that the forest is in the transition period of succession where early species were not completely replaced by the new species. Once the early species will be removed and the climax community develops, the forest has reached the final stage of succession.
Answer: hair color and height.
Explanation:
The claim 'The arrangement of the stars can bring you good luck' is most likely to be based on pseudoscience.
<h3>What is pseudoscience?</h3>
Pseudoscience is defined as knowledge that is not obtained or derived from using the scientific method.
From a scientific perspective, the type of knowledge derived from pseudoscience cannot be verified and therefore is meaningless.
In conclusion, the claim 'The arrangement of the stars can bring you good luck' is most likely to be based on pseudoscience.
Learn more about pseudoscience here:
brainly.com/question/604092
#SPJ1
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Environmental scientists are using GPS ( It is effective but expensive) aerial monitoring (Quick but not the easiest), RFID tags, (mostly for long-term monitoring) and hidden cameras are used to study polar bear behavior without interruption to their environment.
