1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gayaneshka [121]
3 years ago
10

In the adult ovary, more than 90% of the follicles are found as __________.

Biology
1 answer:
marishachu [46]3 years ago
6 0
<span>primordial follicles is the answer 

</span>
You might be interested in
The respiratory disease that cause destruction of alveoli and the elastic fibers in the lung known as whag
lions [1.4K]
It is called emphysema
7 0
3 years ago
Lipids, mainly phospholipids, make up the bulk of the cell membrane. How is the structure of the phospholipid so perfectly paire
anastassius [24]
Im going to say that its <span>d. The head of the phospholipid, which is hydrophilic, helps to control the movement of large hydrophobic molecules, and the tails of the phospholipid, which are hydrophobic, help to control the movement of large hydrophilic moleculeus. </span>
5 0
3 years ago
This is for someone dont even look at the question
oee [108]

Answer:

Explanation:

hi

4 0
3 years ago
Read 2 more answers
Which of the following can be said about the use of agriculture
ExtremeBDS [4]
B - Many Agricultural practices bear some pretty bad impacts on the environment. A, C and D are incorrect.
8 0
3 years ago
I’ll mark brainliest
dedylja [7]
The correct answer is number 2. The reason is the carbonation in the soda water will eventually stop bubbling and therefore the water molecules will still exist.
4 0
3 years ago
Other questions:
  • What is the main type of energy used to help covert rocks into metamorphic rocks in the rock cycle?
    6·1 answer
  • How have Asian giant hornets been useful/good for humans (in Japan)?<br> ASAP!!
    12·1 answer
  • The red bluebird controls its feather color with a single allele they can be blue (dominant) or red (recessive). What are the ge
    13·1 answer
  • The negative effects of tilling include _____. A increased soil erosion B reduced soil drainage C reduced need for energy input
    12·1 answer
  • Which macromolecule is passed from the chloroplast to the
    5·1 answer
  • What di eukaryotes most likely evolve from?
    7·1 answer
  • What is the job of the enzyme telomerase?
    12·1 answer
  • Whitch statement explains how producers are dependent upon consumers for their survival?
    15·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Deserts are defined as regions that have less than ____ inches of rain per year.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!