1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Evgesh-ka [11]
3 years ago
6

Is Biofuels hype or a real solution

Biology
2 answers:
Alex777 [14]3 years ago
6 0

Answer:

Biofuels are currently the most important form of renewable energy in road transportation, but the debate over their environmental impact is ongoing. ... The authors found that most (21 out of 26) biofuels reduce greenhouse emissions by 30 per cent compared with than fossil fuels.

Explanation:

Luden [163]3 years ago
3 0

Answer:

Biofuels are currently the most important form of renewable energy in road transportation, but the debate over their environmental impact is ongoing.  The authors found that most (21 out of 26) biofuels reduce greenhouse emissions by 30 per cent compared with than fossil fuels

Hope this helps :)

Have a great rest of your day love :)

You might be interested in
HURRY PLZ WILL GIVE BRAINLIEST
Anuta_ua [19.1K]

Answer:

Freedom of choice and action

6 0
3 years ago
What type of graph is this?
sergeinik [125]

Answer:

a is the value of kus omak

Explanation:

5 0
3 years ago
Describe how the output of the Krebs cycle can be modified in additional processes of the carbon cycle.
Murljashka [212]

Answer:

Step 1. A carboxyl group is removed from pyruvate, releasing a molecule of carbon dioxide into the surrounding medium. (Note: carbon dioxide is one carbon attached to two oxygen atoms and is one of the major end products of cellular respiration. ) The result of this step is a two-carbon hydroxyethyl group bound to the enzyme pyruvate dehydrogenase; the lost carbon dioxide is the first of the six carbons from the original glucose molecule to be removed. This step proceeds twice for every molecule of glucose metabolized (remember: there are two pyruvate molecules produced at the end of glycolysis); thus, two of the six carbons will have been removed at the end of both of these steps.

Step 2. The hydroxyethyl group is oxidized to an acetyl group, and the electrons are picked up by NAD+, forming NADH (the reduced form of NAD+). The high- energy electrons from NADH will be used later by the cell to generate ATP for energy.

Step 3. The enzyme-bound acetyl group is transferred to CoA, producing a molecule of acetyl CoA. This molecule of acetyl CoA is then further converted to be used in the next pathway of metabolism, the citric acid cycle.

4 0
3 years ago
About 1,500,000 bacteria are found in 1 milliliter of water of coastal ocean. How many bacteria will be there in 100 milliliters
igomit [66]

A single-celled prokaryotic organism that is generally free-living and of few micrometers in length is bacteria. They are very small in size that cannot be seen without a microscope.

1. 5 \times  10^{8} bacteria will be present in 100 milliliters of water.

<h3>How to calculate the number of bacteria?</h3>

Given,

  • 1 milliliter = 1,500,000 bacteria
  • 100 milliliter = ?

\begin{aligned}\rm Bacteria &=\dfrac{ 100 \rm milliliter  \times  1,500,000} { 1 \;\rm milliliter} \\\\&= 1,50,000,000 \;\rm bacteria \\\\&= 1.5 \times  10 ^{8} \;\rm bacteria\end{aligned}

Therefore, option E is correct.

Learn more about bacteria here:

brainly.com/question/2490932

8 0
2 years ago
What was the function of the Tigris River in Mesopotamian irrigation?
Anarel [89]

Answer:

It supplied silt to the nearby farmland

4 0
3 years ago
Other questions:
  • During which period did the presence of stromatolites decline?
    5·2 answers
  • Research suggests that deficiency of vitamin d may lead to:
    5·2 answers
  • Can you think of some specific person or a group of people that would represent the Lorax in the world we live in
    11·1 answer
  • Scientists have documented that spring seasons starting earlier due to climate change have resulted in some caterpillar species
    5·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Bleaching is caused by the addition of bleach containing fertilizers that enter marine systems through runoff. True False
    15·1 answer
  • Which of the following terms are NOT used interchangeably? muscle tension - muscle force in vivo - in the body/ the living muscl
    12·1 answer
  • The modern synthesis theory states that evolution occurs through changes in the gene pool of _____.
    9·2 answers
  • 1. Please describe what sickle-cell disease is and why areas where malaria is common have high frequencies of the sickle-cell al
    15·2 answers
  • A jogger has stepped in a pothole and sprained his ankle. What organ systems
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!