Draw a table that is 2x2. On the top, write a capital R over on box and a lowercase r over the second. On the side, write a lowercase r next to one box and another lowercase r by the other. The top left box would have Rr. The top right would have rr. The bottom left would have Rr and the bottom right would have rr. The probability would be 50%. There is a 50% chance of having wrinkled seeds

4 0

2 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

To manage the grizzly bear population better, the government of Alberta introduced a hunting lottery that awards a limited numbe

11111nata11111 [884]

Answer:

The correct answer is - 1990.

Explanation:

From the graph and year - population size table it is clearly understood that the population of grizzly bear is reduced by 39 number from year 1988 to 1989.

But after 1989 from 1990 onwards population of grizzly bear is consistently rising.

Now, let us analyse the data given in question number 2 .

No. of grizzly bear deaths in Alberta from 1976 to 1988 = 581

No. of grizzly bear deaths in Alberta from 1988 to 2000 = 281

From the above data we can clearly say now that the grizzly bear population deaths starts increasing from 1990.

So, the prediction made in question no. 1 that " the government of Alberta introduced the hunting lottery award in 1990 because in 1989 it decreases and then it starts to go up again in 1990",

5 0

3 years ago