1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leokris [45]
3 years ago
12

Which of Mendel's Laws of Inheritance states that if an offspring of sexually

Biology
1 answer:
allsm [11]3 years ago
6 0
Law of independent assortment
You might be interested in
Skeletal muscle fibers are classified as ""fast"" or ""slow"" based upon what factor?
andrey2020 [161]

Answer:

Skeletal muscles fibre are classified base on how the produce energy.

Explanation:

Skeletal muscles fibres consist of bundles of cells that form muscles which contain myobrills.

Skeletal muscles are classified based on how the produce energy;

Type 1 or slow pitch muscle fibres are more efficient and last for a long period of time. They are use for postural maintenance or endurance. It use aerobic respiration to produce energy or ATP.

Type 11 or fast twitch muscle fibres use anaerobic respiration and are for short speed and fatigue more easily than type 1.

6 0
3 years ago
Read 2 more answers
Where does protein building begin
padilas [110]
Hello,


Protein first starts off in the DNA. Then after through all your muscle cells.



Hope this helps
3 0
3 years ago
What is the name of the period from 2 to 8 weeks following fertilization during which significant growth occurs in the major org
poizon [28]

Answer:

The correct answer is embroynic stage

Explanation:

The prenatal development is divided into three stages germinal stage, embryonic stage and fetal stage. The period of two weeks after fertilization is called the germinal stage. In this stage, the zygote divided and gets implanted in the uterine wall.

The embryonic stage starts for two weeks and lasts up to 8 weeks after fertilization. At this stage, the cell mass is called embryo. In the embryonic stage, the basic brain structure, CNS, PNS are developed. All the basic organs and body parts develop in this stage except sex organs. So the right answer is the embryonic stage.

3 0
3 years ago
Please help I only have 25 minutes
Aloiza [94]

Answer:

Explanation:

What is the question? I can't see it or read it. Too small

5 0
3 years ago
What kind of cell were you able to make, animal or plant?​
QveST [7]

Answer:

eukaryotic

Both plant and animal cells are eukaryotic, so they contain membrane-bound organelles like the nucleus and mitochondria

5 0
3 years ago
Other questions:
  • PLSSSSS HELP :(
    14·1 answer
  • The round third prong on a grounded plug ______.
    11·1 answer
  • Identify What are two unique characteristics shared by all birds?
    12·1 answer
  • 7. What are the two reactions that take place during aerobic respiration and where do they occur?
    13·1 answer
  • Jayden created a cell model using a glass bottle with a cork. he said that the cork could be opened to eliminate waste material
    5·2 answers
  • Who takes care of the final layout of the product that meets the standards set by LUX designers?
    14·1 answer
  • What chemical gets released at the end of neuron to transmit an impulse to the next neuron?
    9·1 answer
  • What is the fate of the products produced from photosynthesis​
    8·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • 3. Predict: Based on your hypothesis, predict how changing the rabbit population will affect the other organisms at first. Write
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!