Answer:
What didn't hlsee man what is this
Answer:
TAGCTTTAAAGCGTCGATGCT
Explanation:
A AND T are complimentary and G and C for DNA
Answer:
between 1 and 50 million times
Explanation:
A light microscope can magnify things up to 2000x, but an electron microscope can magnify between 1 and 50 million times depending on which type you use! To see the results, look at the image below.
Personification
The phrase emphatic iron of the fence is an example of personification
.
Personification is a figure of speech in which human qualities is assigned to something that is not human or not alive such as an animal, objects, or emotions. Personification is used to emphasize and describe a sentence for it to be clearly understood.
In the question given; The phrase emphatic iron of the fence is an example of personification
. The iron of the fence was personified as the word ‘’emphatic” which is a human attribute was assigned to it in the sentence.
