1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nadezda [96]
2 years ago
12

The principal gas in the biogas produced in a landfill is

Biology
1 answer:
BlackZzzverrR [31]2 years ago
3 0

Answer:

Biogas is composed mostly of methane (CH4), the same compound in natural gas, and carbon dioxide (CO2).

Explanation:

You might be interested in
Please Help<br> Sex-Linked Disorder
Masteriza [31]

Explanation:

hemopholia

colour blindness

8 0
3 years ago
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Which of the following is a organic molecule
damaskus [11]

Answer: you didn't state the answers to choose from so i"ll just list common organic molicules: nucleic acids, proteins, carbohydrates and lipids.

Explanation:

3 0
3 years ago
You are a fitness specialist. one of your clients is a long distance cyclist. he complains of bilateral numbness in the little f
kondor19780726 [428]

I think he had an acident and he forgot or maybe of cycling alot he had this problem

8 0
3 years ago
This energy flows through organisms and the environment and eventually flows out of the biosphere as
kakasveta [241]

Heat is then the by-product of the light energy from the Sun flowing through the biosphere. Organisms are inevitably dependent on sunlight to perform essential biological processes in order to sustain life. In the absence of this energy, all the organisms on Earth would die. 



8 0
3 years ago
Other questions:
  • Greg is telling his teacher how a cell is like a house. Which part of a cell is like the air in Greg's house? Cell membrane Cell
    5·2 answers
  • Choose the sentence that does not describe a structural adaptation. A. An elephant has a long trunk that it uses to reach leaves
    15·2 answers
  • In the first stage of cellular respiration (glycolysis, two molecules of pyruvate are produced. in the remaining stages of cellu
    8·1 answer
  • A BbGg x bbgg cross yields a phenotypic ratio of approximately 5 black eyes, green skin : 5 orange eyes, white skin : 1 black ey
    9·1 answer
  • I need help with this question
    8·1 answer
  • Explain how an organism that possesses the citrate lyase enzyme
    8·1 answer
  • The phosphate transport system in bacteria imports phosphate into the cell even when the concentration of phosphate outside the
    12·1 answer
  • Sexual reproduction creates
    12·2 answers
  • Does anyone know if these are correct, I’m just asking because idk if they are correct or not.
    10·1 answer
  • 20 POINTS!
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!