Answer:
Los organismos unicelulares se componen de una sola célula que lleva a cabo todas las funciones necesarias por el organismo, mientras que los organismos multicelulares utilizan muchas células diferentes para funcionar.
I think the answer is ears if Spain is supposed to be spin and war is supposed to be head
Answer for this question will be
3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'
Answer:
Aunt Lenora's voice was a choir of angels.
Explanation:
a figure of speech in which a word or phrase is applied to an object or action to which it is not literally applicable.
