1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Akimi4 [234]
2 years ago
14

Bonjour ☺️

Biology
1 answer:
garri49 [273]2 years ago
6 0

Answer:

les glandes produisent deux produits essentiels :

-gamètes. les mâles produisent du sperme et les femelles produisent des ovules (œufs). la formation des gamètes dépend d'un type particulier de division cellulaire appelé méiose

-hormones sexuelles. ces hormones stéroïdes - principalement la testostérone chez les hommes, les œstrogènes et la progestérone chez les femmes - jouent un rôle vital à la fois dans le développement et la fonction des organes reproducteurs et dans le comportement et les pulsions sexuelles. ces hormones influencent également la croissance et le développement de nombreux autres organes et tissus du corps

Explanation:

You might be interested in
Name the 4 major groups of organic compounds
pshichka [43]
Nucleic acid
proteins
carbohydrates
lipids
4 0
3 years ago
Which discovery did Gregor Mendel make?
dolphi86 [110]

Answer:

Gregor mendel throught his work on pea plants discovered the fundimental laws of inheritance he deduced that genes come in pairs and are inherited as distinct units

example in picture hope it helps

3 0
3 years ago
Describe How water is tested for color in platinum cobalt method​
Alecsey [184]

The color produced by one milligram of platinum cobalt in one liter of dissolved water is fixed as one unit of color in platinum-cobalt scale.

5 0
3 years ago
Read 2 more answers
In a population of tree frogs, the allele that causes yellow eyes (Y) is dominant over the allele that causes orange eyes (y). I
Alex787 [66]

Allele that causes yellow eyes (Y) is dominant over the allele that causes orange eyes (y)

Y = 85% = 0.85 and

y = 100% - 85% = 15% = 0.15

f(y) = square root of y = √y = √0.15 = 0.387

frequency of the allele that causes orange eyes = 0.387

Once we know the value of y, Y + y = 1

Putting the value of y, we get

Y = 1 – 0.387

<span>Frequency of the dominant allele that causes yellow eyes = 0.61</span>

4 0
3 years ago
Describes a change of the sequence of a dna molecule
zvonat [6]

Answer:

mutation

Explanation:

occurs when a DNA gene is damaged or changed in such a way a to alter the genetic message carried by that gene. A mutation is an gent of substance that can bring about permanent alteration to the physical composition of a DNA gene such that the genetic message is changed

7 0
2 years ago
Other questions:
  • Federico has two samples of pure water—sample X and sample Y. Sample X has a volume of 1 L, and sample Y has a volume of 10 L. H
    11·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What is vertical feeding pattern
    8·1 answer
  • The illustration shows a representative food web found in the marine environment. What would happen to this food web if the phyt
    5·1 answer
  • What can scientist observe over long periods of time to determine the patterns in climate change?
    12·1 answer
  • What do all multicellular organisms need for sexual reproduction to occur
    14·2 answers
  • According to the guidelines for standard precautions, the caregiver's hands should be washed: a. after touching any body fluids
    10·1 answer
  • State two proteins in blood which are responsible for determine the blood group of a person​
    5·1 answer
  • 5. Genes code for<br> O lipids<br> O carbohydrates<br> O protein
    12·1 answer
  • Erythrocytes might the best of example of form equals function because they lack many organelles. What organelles are absent in
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!