1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tamaranim1 [39]
2 years ago
12

TRUE/FALSE All proteins structures are related to their function​

Biology
1 answer:
irina [24]2 years ago
6 0

Answer:

True

Explanation:

a protein's unique shape determines its function.

You might be interested in
During the descent of a single-leg squat, a client's knee moves inward. Which of the following muscles should the trainer recogn
Evgen [1.6K]

Answer:

vastus lateralis

Explanation:

Based on the information provided within the question it can be said that in this scenario the trainer should recognize the vastus lateralis as needing static stretching. This is because this muscle's only task is to extend the lower leg and thus allowing the body to lift itself up from a squatting position. Which is exactly what the client is currently doing in this scenario.

7 0
3 years ago
Х
Neporo4naja [7]

Answer:

biologie is klote, net zoals je nu doodgaat

5 0
2 years ago
A forty-five-year-old woman is a heavy drinker, smoker, and has had many sexual partners. Certain types of the female reproducti
WINSTONCH [101]
<span>D.
her sexual behavior and smoking</span>
4 0
3 years ago
Read 2 more answers
Which of these checkpoints determines if cell division has occurred properly?
Tomtit [17]
<span>Cell division has two checkpoints namely, G1 checkpoint and spindle assembly checkpoint. The checkpoint which determines if division has properly occurred is the G1 checkpoint. At this point, is a damage in the DNA is detected or the has not reach the optimum size, the cell is stopped in G1 and is not allowed to proceed to further process.</span>
8 0
3 years ago
The information in dna is contained in __________.
ELEN [110]

Answer:

the cell nucleus

8 0
2 years ago
Other questions:
  • In a small group of people living in a remote area, there is a high incidence of "blue skin" a condition that results from a var
    10·2 answers
  • What abiotic factors have people changed
    13·1 answer
  • 6. When humans first appear on Earth?
    5·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Our experiment was to keep one seedling set in a light place and the other set in a closed cardboard box. So my question is to e
    10·1 answer
  • Put "Genetic Variation" in a sentence
    14·2 answers
  • Does cellular respiration give a runner more energy than lactic acid fermentation
    9·1 answer
  • Whoever gets it right i will mark brainest
    14·1 answer
  • It is possible for a repressor to negatively regulate the expression of an operon because: A. the repressor-binding site overlap
    12·1 answer
  • PLEASE HELP ME ITS FOR SCIENCE DUE TODAY!! (Punnett Squares!)
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!