The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
<h3>What is a sense DNA strand?</h3>
DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
brainly.com/question/1048150
Nails form from molten iron is considered a Physical change. Why? The molten iron is just heated in order to form a different shape which is the nail but its chemical composition is still the same. The chemical composition of the nail is still the same with iron.
These are spores, which are produced by bacteria and are involved in survival or reproduction. Some different types include endospores, which are heat-resistant spores formed within the cell, cysts, which are dormant cells sometimes enclosed in a sheath, arthrospores, which are produced by different bacteria as part their reproductive cycles and myxospores, which are formed within a fruiting body.
Answer:
Yes, different cell types also have special duties, like building skin or bone, pumping out hormones, or making anti-bodies.
Explanation:
Cell is the basis structural and functional unit of a living organism. The body of a human is composed of trillions of cells that are organized in around 200 types of cells.
<u>A tissue is simply a group of specific kind of cell that have a specific role.</u>
- For example: The nervous system contains cells called neurons that have ability to transmit message from one place to another and allow us to respond to any environmental stimuli, such as heat, cold, danger etc.
- Skin cell is composed of cells that have a role in protecting the body against the attack of harmful microbes. They also protect have role in building new skin cells and adding the protection to our body.
- Blood cells have a role in providing us immunity (for example white blood cells) therefore, make us better able to protect ourselves from danger of diseases.
- Muscle cells help us in moving our organs as well as allowing the whole movement from one place to another.
Thus we see that different types of cells have special functions and all these different cells coordinate with each other to make an organized and functioning body of a living organism.
Hope it help!
Answer:
Explanation:
Eating well is fundamental to good health and well-being. Healthy eating helps us to maintain a healthy weight and reduces our risk of type 2 diabetes, high blood pressure, high cholesterol and the risk of developing cardiovascular disease and some cancers.
