1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ddd [48]
3 years ago
8

What is the term for the protective wall that helps bacteria survive unfavorable conditions?

Biology
1 answer:
Ainat [17]3 years ago
7 0
I think the answer is Endospore. I'm sorry if I'm wrong...
You might be interested in
In a paragraph explain what effect very small pores and their diffusion rate would have on the workings and mechanism of a cell
Murrr4er [49]

Answer:

So if the size of the pore is small then the rate of the diffusion will be very slow as the molecules will move from high concentration to low concentration in very slow rate.

Explanation:

I hope it helps you

6 0
3 years ago
Consider the phylogenetic tree. Which two organisms are most closely related, based on the tree above?
Aleksandr [31]
Answer: dinosaurs and birds
Plentiful collection of f<span>ossils of early birds and their most immediate predecessors has settled the century-old controversy about the origin of birds. Birds are now safely declared to evolve from a group of dinosaurs known as maniraptoran theropods. Birds have similar shape of the bones as a variety of maniraptorans have.  A host of fossils have shown also that the maniraptorans lay looked alike eggs as that of birds and they resemble the birds in the way they laid their eggs also. Those reasons prove that they are most closely related.</span><span>
</span>
5 0
3 years ago
Read 2 more answers
The mitotic spindle and microtubules were not present in the mitosis models; describe their process throughout the steps of mito
Alex777 [14]

Answer:

Following are the solution to this question:

Explanation:

In a spindle in prophetic (mitotic apparatus) spindle, pulley and cellular membranes form at the kinetochore of metaphase genes intended besides separation of anaphase daughter chromosomes.

Even though the cycle of creation of the cells move towards opposite poles, microtubules gradually form a network between them, and its duplicate chromosomes would be later removed.

8 0
3 years ago
6. Which generations saw a population altering incident? Use your imagination to invent a
elixir [45]

Answer:

Which generations saw a population altering incident? Use your imagination to invent apossible environmental incident that could have caused this shift in populations. The white bears saw a population altering incident because in generation 6 the number wentdown pretty unexpectedly.

8 0
3 years ago
3. Jill is blood Type O. She has two older brothers with blood types A &amp; B. What are the genotypes of
Alborosie

Answer:

AB & O

Explanation:

3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following plants would have succeeded in colonizing the land early in Earth’s history and become an ancestor of mod
    10·2 answers
  • Is evolution and speciation the same process?
    12·1 answer
  • I have to choose between acidic nature, solubility water, and ability to form crystals and the question is
    9·1 answer
  • The role of photosynthesis in the cycling of matter and flow of energy into and out of organisms
    15·1 answer
  • Name the two kinds of endoplasmic reticulum
    14·2 answers
  • A common element among all the river valley civilizations was:
    14·2 answers
  • How can a liquid be drawn into a pipette safely?
    11·2 answers
  • How can we stop the amount of emissions that contribute to greenhouse gases?
    5·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What occurs during cell differentiation?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!