Answer:
B.) is the process of taking materials into the cell
Explanation:
A.) is incorrect because endocytosis move things into the cell by collapsing the cellular membrane around the substance and then budding off.
C.) is incorrect because the material is not always directed to the endoplasmic reticulum. Most the the material is directed to the lysosomes.
D.) is incorrect because phagosomes are created during phagocytosis, a special type of endocytosis.
Answer:
1. 2 red: 2 purple
2. 2 red: 1 purple: 1 white
Explanation:
For this question, you need to create two separate punnett squares. The first punnett square would have C^R over one square with C^P in the square next to it, and on the other side would C^P next to one square and C^W next to the square below it. It doesn't matter what side you put the alleles on, just make sure the same alleles of the same flower are on the same side. Then, in order to find the phenotype, or in this case the color of the flowers' offspring, follow the dominance rules the question gave you. Remember, alleles don't have to be homozygous to determine what color they will be. Just make sure that the dominant allele is the allele used to determine the color. The same rules will apply for the second punnett square, and then you should get your answer. Hope this helps! :)
Answer:
i believe its C
Explanation:
more salinity means the ecosystem has to adapt to be more tolerant of salt, so that excludes A and D. Evolution is the kind of thing that takes time, so when life has to adapt it isn't overnight, so this leads me to choosing C, because over time the species in the area will adapt to become more tolerant in salt.
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
Answer:
True. This is true for photosynthesis and respiration.
