The correct answer is the suprachiasmatic nucleus of the hypothalamus. The suprachiasmatic nucleus, as the name suggests, is the part of the hypothalamus located in right above above the optic chiasm. The main function of the suprachiasmatic nucleus is mainly responsible for the circadian rhythm of the body therefore the physiological activity on daily cycles.
C.tt is the correct answer
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Low power is usually used for scanning a slide. This lets the person see more of the slide at once.
