1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
FromTheMoon [43]
2 years ago
15

Respiration is ...

Biology
1 answer:
gizmo_the_mogwai [7]2 years ago
8 0
A catabolic because it breaks down sugar
You might be interested in
Help me plz
skelet666 [1.2K]
False. The Beatles were popular in the 1970s
6 0
3 years ago
Read 2 more answers
Which of these is true for a daughter cell produced by mitosis?
cluponka [151]

The answer is A

Mitosis creates two identical daughter cells that each contain the same number of chromosomes as their parent cell. In contrast, meiosis gives rise to four unique daughter cells, each of which has half the number of chromosomes as the parent cell.

8 0
2 years ago
Read 2 more answers
Explain how a mutation in a bacterial cell could help it become resistant to infection by a bacteriophage
zhenek [66]

Bacteria have different phage resistance mechanisms, such as spontaneous mutations, the CRISPR-Cas system.

Spontaneous mutations are the main mechanisms leading to phage resistance by altering the structure of bacterial wall components that act as phage receptors. These include lipopolysaccharides (LPS), outer membrane proteins, cell wall teichoic acids, capsules, and other bacterial components.

6 0
3 years ago
What is found in the nucleus of an atom? Question 1 options: electrons neutrons and protons protons and electrons neutrons and e
ladessa [460]

Answer: in the atom you can find: electrons and protons

Explanation:

You can find electrons in an atom because it is the negative energy that rounds the atom on the outside’s part.

Then, the protons are the positive energy that is on the atom’s inside.

Both of the energies are fused and it end on a neutron energy.

4 0
3 years ago
Read 2 more answers
start this thing that red pandas and raccoons are more a recent common ancestor that red pandas and giant pandas do if true what
adelina 88 [10]

Answer:

D

Explanation:

im going to guess its a cause think of it this way its like family in a way if raccoons and red pandas are a more common ancestor than they might have been family along the lines of history somewhere if its not a than d i hop this helps and id pick d it sounds more frequent

7 0
3 years ago
Other questions:
  • When dna begins to replicate, two strands of the dna helix are separated, forming a replication bubble. at each end of the bubbl
    14·1 answer
  • Which of these is least likely to be an adaptation of an organism to its environment?
    13·1 answer
  • What are the characteristics of continental tropical air
    6·1 answer
  • Look at fig. 132 where the Punnett square shows a homozygous red grapfruit
    15·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • HELP ME!!<br> Albinism over powers the gene for skin color this is an example of
    11·2 answers
  • How is The processes of photosynthesis and respiration are interrelated
    7·2 answers
  • What are the results of desertification
    14·1 answer
  • Three bird species share a habitat Bird A eats insects and plant seeds. Bird B drinks flower nectar. Bird C eats plant seeds. A
    13·1 answer
  • HELP IM DOING A TEST
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!