1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jok3333 [9.3K]
2 years ago
8

Why is spotify still streaming when i have cell data off.

Biology
1 answer:
fgiga [73]2 years ago
3 0
I really don’t know that’s really confusing... do you still have Internet or do you have self internet turned on?
You might be interested in
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Is food code an administrative law, federal law, or state law
Alecsey [184]

Answer:

administrative law

Explanation:

i learned this

6 0
3 years ago
Why do we (most likely) have the sense of color?
Solnce55 [7]

Answer:

Cones and rods in our eyes

5 0
3 years ago
The different forms of a gene for a given trait are called
irina [24]

alleles

ggggggggggggggggggggggggggggggggggggggggggggg

8 0
3 years ago
Read 2 more answers
HELP! Will give brainly!!<br><br> What happens when an antibody and antigen react?
laiz [17]
It causes pathogens to stick together.
8 0
3 years ago
Read 2 more answers
Other questions:
  • 2. The Köppen classification system is used as a classification system for
    6·1 answer
  • In what ways do organelles make a cell more efficient
    14·2 answers
  • Pain sensations in the skin, muscles, tendons, and joints that are carried on large nerve fibers are called ________.
    8·1 answer
  • you ride your bike to a friends house that is 5 km from yours. it takes half an hour to do this . what is your speed?
    12·2 answers
  • Two causes of the ocean
    15·2 answers
  • Based on the information in the chart, what can we conclude about the functionality of various sized beaks.
    10·1 answer
  • Polygons EFGH and E'F'G'H' are shown on the coordinate grid:
    5·1 answer
  • Rock pocket mice with different color variations are observed in the desert regions of Arizona. The fur color of the mice helps
    5·2 answers
  • Catherine is working on a study of different groups of animals. In which group of animals would she find the most diversity?
    15·2 answers
  • Why do scientists monitor the effect of each method
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!