1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jok3333 [9.3K]
2 years ago
8

Why is spotify still streaming when i have cell data off.

Biology
1 answer:
fgiga [73]2 years ago
3 0
I really don’t know that’s really confusing... do you still have Internet or do you have self internet turned on?
You might be interested in
Sea turtles enter a high-energy state called ___ after they hatch.
blondinia [14]
ANSWER: the state is called Frenzy
5 0
2 years ago
Rocky shores serve as a feeding ground for
vitfil [10]
Lichens are prominent on rocky shores.
8 0
3 years ago
Question 1(Multiple Choice Worth 3 points)
shepuryov [24]

Answer:

1. It involves multiple trials

2. 2 red: 2 white

3. Process 1 describes cloning and process 2 describes artificial selection

4. Furry Feet

5. Large scale insulin could be produced in relatively lesser time

6. A lowercase letter

7. 0%

8. rr

9. 50%

10. The allele for white flowers is recessive in the pea plant

Explanation:

1. Repetition, this means to do over and over. This would involve multiple trials and this is done to test the reliability of the results and determine if the hypothesis holds true or not.

2. If you put your cross in a Punnett square it would look like this:

      R    r                            

r     Rr   rr                          

r     Rr   rr

Based on your problem: R = red; r = white

If the genotype would have a dominant allele (R), then the dominant trait will come out, if it has only recessive alleles (r) then the recessive trait will come out. So as you can see there are 2 red and 2 white. So the ratio would be 2:2 or 1:1.

3. Process 1 is considered as cloning, and to be more specific, reproductive cloning. The aim of this is to produce an offspring that has the same genetic make up as the original or parent organism. Process 2 is an example of artificial selection. This is also known as selective breeding where breeders choose certain traits to pass on to the off springs by selecting the organisms that have the traits desired.

4. Furry feet of polar bears provide them extra traction when they walk on snow. The fur also provides extra warmth. They also have foot pads on the soles of their feet that help them as well. Together, polar bear have something that works like snow boots.

5. Large-scale insulin could be produced in relatively lesser time because bacteria reproduce through asexual means. They produce copies of themselves that are genetically identical. An advantage of asexual reproduction is the process occurs in a much faster rate. With that said, insulin supply would increase, which will help many diabetic patients.

6. Recessive alleles in a genotype are represented by a lowercase letter. On the other hand, dominant alleles are represented by a capital letter. Squares and circles are used in pedigree charts to represent the whole genotype of an organism for a specific trait.

7. The answer would be 0% because cystic fibrosis is a RECESSIVE gene disorder. For it to be expressed or observable in an individual , t<u>hey should have two recessive alleles</u>. As you can see in the end result, none of the offsprings have 2 recessive alleles. The genotype Aa, has a recessive allele, but it will not be expressed because the dominant trait will mask it.

8. When we talk about homozygous, this means the alleles are the same. And when you say heterozygous, this means that the organism would have a dominant and recessive allele. the recessive llele is represented by a lowercase letter. So if the organism is homozygous recessive, the genotype would have two lowercase letters. (rr)

9. The scenario shows the genotype is pp. This means that the pea plant is homozygous recessive. As explained before, recessive traits are represented by lowercase letters. So this would mean that the white color is a recessive trait. The answer would then be the allele for white flowers is recessive in the pea plant.

10. Mitosis and meiosis are both forms of cell division. Mitosis produces daughter cells that are exactly the same as the parent cell, while Meiosis produces daughter cells that are different. They produce what we call haploid cells, which has only half the chromosomes of the parent cell. Gametes or sex cells are produced through meiosis, while body cells are produced through mitosis.

6 0
3 years ago
Read 2 more answers
Cell wall is secreted by:<br> (a)nucleoplasm (b)golgi complex (c)ribosomes (d)protoplasm
Mumz [18]

Answer:

A

Explanation:

4 0
2 years ago
What are the two reactants that plant cells need to do photosynthesis?
s344n2d4d5 [400]
Carbon dioxide and water (and sunlight)
7 0
3 years ago
Other questions:
  • How do breathing passages help keep pathogens out of the body?
    13·1 answer
  • Innate immune response to viral and bacterial infections are different. One similarity is that pathogen derived antigens are pre
    15·1 answer
  • How thick is the exosphere?
    7·1 answer
  • The appearance of banded iron layers in the rock record between 1.08 and 3.8 billion years ago reflect the alteration of oxygen-
    10·1 answer
  • Are these right so far and could some one help me with the last one
    8·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What did you know for sure after one test? two test? three test?
    15·1 answer
  • Explain why it is correct to say that the air and good passages cross in the pharynx?
    14·1 answer
  • Question 13 of 34
    12·1 answer
  • Define the term developed nation
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!