What structure is found in prokaryotic cells but not eukaryotic cells?
a. a single, circular DNA chromosome found in the cytoplasm
because :
Prokaryotic cells may also contain extrachromosomal DNA, or DNA that is not part of the chromosome. This extrachromosomal DNA is found in plasmids, which are small, circular, double-stranded DNA molecules.
D) A & B
it protects the seed against any damage or harmful weather conditions and also helps in dispersal of the seed through different means.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: