1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dima020 [189]
3 years ago
10

What is a thigh trap in soccer?

Health
1 answer:
kirza4 [7]3 years ago
4 0
The exact definition is "When a player uses his thigh to slow down and control a ball in the air."
You might be interested in
An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication​
s2008m [1.1K]

Answer:

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

5 0
4 years ago
Which of the following is not involved in the flow of lymph
Anna35 [415]
The answer is B because it is B
6 0
3 years ago
Patients with rhinitis often have watery eyes because ______.
ivolga24 [154]

Answer:

Allergies

Explanation:

Allergies can produce many of the same cold-like symptoms as a sinus infection, including sinus pressure, a runny nose and congestion. ... One of the key ways to tell if you are experiencing allergic rhinitis is if you have itchy, watery eyes along with your other symptoms.

7 0
3 years ago
Read 2 more answers
Organs are comprised of tissues that work together to perform a specific bodily function
weeeeeb [17]
A tissue<span> is a group of many similar cells .</span><span>An </span>organ is<span> an anatomically distinct structure of the </span>body composed<span> of two or more </span>tissue<span> types.</span>Organs<span> that </span>work together<span> are grouped into </span>organ<span> systems.</span>
8 0
3 years ago
DID I PASSS FR THANK GOD
Ivenika [448]

Answer:

nicely done only

cuz of the admins

8 0
3 years ago
Other questions:
  • why would someone suffering from alzheimer's play checkers well but have a hard time holding a sensible conversation
    9·1 answer
  • Frostbite __________. A. is caused when an animal bite is exposed to cold weather B. results when tissues are damaged by extreme
    14·2 answers
  • What approach would you recommend that low- and middle-income countries take to prevent and control unintentional injuries? Grou
    10·1 answer
  • A nurse is caring for a sleepy newborn. what are interventions the nurse can use to help the sleepy newborn receive adequate nut
    8·1 answer
  • Diagnostic coding and reporting guidelines for outpatient services take precedence over the general and disease-specific guideli
    10·1 answer
  • Chapter 12 REVIEW
    14·1 answer
  • Describe the causes, symptoms<br> and treatment of eating disorders?
    9·1 answer
  • Dance Basics Word Search
    5·2 answers
  • Which of these is one right guaranteed by the ACA's Patient Bill of Rights?
    8·1 answer
  • A bee covered with pollen sitting on a flower, dandelion seeds being blown away by the wind, a squirrel burying nuts in the grou
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!