1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex73 [517]
3 years ago
11

An increase in the volume of forests and phytoplankton would lead to a reduction in free_________ which in turn could cause a de

crease in carbon dioxide in the atmosphere.​
Biology
2 answers:
Vesnalui [34]3 years ago
6 0

Answer: Carbon Dioxide and other green house gasses

Explanation:

Katarina [22]3 years ago
4 0

Answer:

"Carbon"

Explanation:

Just did it

You might be interested in
fossils give scientists information regarding the living conditions and characteristics of organisms that were found on the eart
Serggg [28]
Hello Wtfiswrongwitmeh, using radiocarbon dating, or carbon dating, you can determine the age of an organic object from the relative proportions of the carbon isotopes it contains. Therefore, if you take the fossils form the fossil record and determine how old they are, you can see how/if they evolved over time.
7 0
3 years ago
2+2=???? idkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidkidk
Tasya [4]

Answer:

4

Explanation:

2+2=4. It is a very complex equation. Hope this helps!

-Aslina

7 0
4 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
Kelp plants have been known to grow up to _______.
ycow [4]
I believe the answer is C. 10 inches per day

4 0
3 years ago
Read 2 more answers
What is likely happening at the boundary between the Nazca plate and the<br> Pacific plate?
Darina [25.2K]

Answer:

Where the two plates meet, the denser oceanic lithosphere of the Nazca Plate is forced down and under the more buoyant continental lithosphere of the South American Plate, descending at an angle into the mantle in a process called subduction.

4 0
3 years ago
Other questions:
  • What nursing delivery of care provides the nurse to plan and direct care of a group of clients over a 24-hour period?
    11·1 answer
  • Which term is used to describe a fact that has always been observed true but could at some future time not be observed as true.
    10·1 answer
  • The joining of nuclei and chromosomes is known as __________. incubation fertilization inoculation gestation
    12·2 answers
  • How does the location of nodules relate to the function of the nodule? Explain.
    6·1 answer
  • What would most likely occur if the interaction is blocked between the pituitary and gland C, the site of meiosis in males?
    7·1 answer
  • Consider the impacts on the bird population and its gene pool. __________ is responsible for gene flow and an important mechanis
    15·2 answers
  • In natural selection what determines which color grey or green is advantageous
    12·1 answer
  • PLS HELPP MEEEE I WILL GIVVEE BRAINLIEST
    14·2 answers
  • During an experiment, India examines prepared slides that her teacher has given her. One of the slides shows a single-celled org
    5·2 answers
  • Look at the teeth in the lions mouth. how is the structure of the lions teeth an adaptation
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!