1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Maurinko [17]
2 years ago
9

How are glucose and glycogen related?

Biology
1 answer:
Setler79 [48]2 years ago
7 0

Answer: c

Explanation:

This stored form of glucose is made up of many connected glucose molecules and is called glycogen

You might be interested in
Which digestive hormone is secreted when fats and carbohydrates, especially glucose, enter the small intestine?.
blsea [12.9K]

Gastric inhibitory peptide (GIP) a digestive hormone is secreted when fats and carbohydrates, especially glucose, enter the small intestine.

  • A member of the secretin family of hormones, glucose-dependent insulinotropic polypeptide is an inhibitory hormone.
  • It is sometimes referred to as gastric inhibitory polypeptide or stomach inhibitory peptide.
  • The enteroendocrine K-cells, which are widespread in the small intestine secrete GIP.
  • The hormone gastric inhibitory polypeptide, which is released by intestinal mucosal cells, prevents the stomach from producing hydrochloric acid.
  • Additionally, it improves the islets of Langerhans' beta cells' ability to secrete insulin, which results in a considerable increase in blood insulin concentrations following oral glucose delivery.

learn more about Gastric inhibitory peptide here: brainly.com/question/13048001

#SPJ4

4 0
1 year ago
Why are endemic organisms in greater danger of becoming extinct?
Liula [17]

Answer:

They are the species which are found only in a particular area. They can be a plant, animal or microorganism. They are at great danger of becoming extinct due to the following reasons: - As they are restricted to a particular area so loss of their habitat is the major reason which could lead to extinction.

Explanation:

5 0
3 years ago
Describe briefly the interactions between abiotic and biotic components of an ecosystem
Delvig [45]

Answer:

Plant as a biotic component needs sunlight an abiotic component to photosynthesize

3 0
2 years ago
Read 2 more answers
Organisms that live in deciduous forests have developed unique adaptations that aid in their survival. How are the bill and feet
Reil [10]
95% sure it is answer B) Detect the electrical discharges of prey in the sand using small pits on it's bill, crush the food with grinding pads on the top and bottom of it's bill (they don't have actual teeth), and webbed feet.

I did some quick research and it had all of those things. 
Hope this helps.
6 0
3 years ago
Read 2 more answers
Pcr is used to amplify a segment of dna and the enzyme responsible for the replication of dna is
Andru [333]
Practis coloring right
4 0
3 years ago
Other questions:
  • Where does the light energy of a glowing light wand come from?
    12·2 answers
  • Which amendment outlawed the manufacture, sale, transportation, important, or export or alcoholic beverages
    6·2 answers
  • Which of these are not examples of matter
    10·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • What best describes a gamete
    13·2 answers
  • How is your community like the human body, give two examples
    11·2 answers
  • Refers to the tendency people have to react to stimuli similar to an original stimulus in a classical conditioning situation in
    13·1 answer
  • What is the term for an atom that decays?
    15·1 answer
  • You are a researcher interested in a rare, highly endangered bird species that lives in a very remote area of the Amazonian rain
    15·1 answer
  • Solution A has a pH of 5, and Solution B has a pH of 6.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!