Which Statement Best Describes How A Dominant Gene Is Different From A Recessive Gene

1 answer:

4 0

Since this is a "which statement best" question, it's useful to us if you provide the statements. A dominant gene is always expressed in the offspring, no matter what the corresponding gene received from the other parent is. A recessive gene is only expressed when the offspring receives one from each parent.

You might be interested in

If a decision was made to drain wetlands for agricultural reasons, which statement is false?

IrinaK [193]

First the question is asking If a descision was made to drain the wetlands which a wetlands is haves rich soil and nutrients which is good for farming and an agricultural action means someone would clear out a forest of farming reasons so I would say the answer is A

7 0

2 years ago

Read 2 more answers

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

Which action could a student take to make a longitudinal wave?

Pavlova-9 [17]

Answer:

Explanation:

Because a Longitudinal wave is a wave vibrating in the direction of propagation.

3 0

2 years ago

Read 2 more answers

List the four classes of the phylum protozoa and their locomotory organelles

7nadin3 [17]

Answer:

Approximately, 50,000 types of Phylum Protozoa have been identified. Its four divisions are Amoeboid Protozoa or Sarcodines, Flagellated protozoans or Zooflagellates, Ciliated protozoa or Ciliates and the Sporozoans.

<h3><u>PLEASE</u><u> MARK</u><u> ME</u><u> BRAINLIEST</u></h3>

7 0

2 years ago

Read 2 more answers

Two methods of biotechnology used by scientists are described below.

agasfer [191]

Answer:78

Explanation:

5 0

1 year ago