1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Jet001 [13]
2 years ago
15

1. Herbivores are also called__________consumers.

Biology
2 answers:
Stella [2.4K]2 years ago
7 0

Answer:

1. primary

2. protozoa, (or fungi), bacteria

Explanation:

lmk if im wrong & I'll fix it.

gayaneshka [121]2 years ago
6 0

Explanation:

I SUPPORT THE ABOVE PERSON'S ANSWER

You might be interested in
Identify two general ways chemical mutagens can alter dna.
gavmur [86]
1) compound mutagens can go about as base analogs 
Analogs are perceived by DNA polymerase and consolidated into DNA set up of nucleotides and after that reason change by base-matching in a way that varies from the undifferentiated from nucleotide. For instance, 5-BrdU can be consolidated inverse An amid replication and after that combine as a C amid the following round of replication, making a TA CG change. 
2) substance mutagens can synthetically adjust base. 
Compound adjustment of bases changes their base-blending properties to such an extent that an altered purine will base-match with the wrong pyrimidine and the other way around. For instance, EMS is an alkylating operator that proselytes guanine to O6-methylguanine, which base-sets with T to make a GC to AT progress
6 0
3 years ago
As air moves from the base up the side of a mountain, it cools. What is one consequence of this movement of air?
katen-ka-za [31]
Moisture will drop as rain as the air moves up the side of the mountain.

Hope this helps!
8 0
3 years ago
It is important to organize your data because
Serggg [28]
You want to be able to present your conclusion properly
6 0
3 years ago
True or false? leisure-time physical activity(pa) has been noted to provide greater protective benefits against heart disease in
harina [27]

the answer is true.Hope it helps

7 0
3 years ago
Which of the following steps is an important part of the process by which ecology guides humans to a sustainable future?
Helen [10]
The step that is an important part of the process by which ecology guides humans to a sustainable future is that behavior is changed after the cause of the problem is identified. The correct answer is D.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is transported by the blood?
    14·2 answers
  • Which organic macromolecule is used for long-term energy storage?
    8·1 answer
  • Populations of _________ live in the human large intestine. These benficial organisms help make certain vitamins and digest poly
    12·2 answers
  • A healthy environment depends on biogeochemical cycles maintaining a balance of input and output. High levels of nitrogenous com
    11·1 answer
  • If a plant were to absorb a substance that inhibits the light reactions, the
    7·1 answer
  • Which of the following is not a step in the process of natural selection
    11·1 answer
  • An older adult client has a decubitus ulcer with drainage, dysphagia, and immobility. She consumes less than 300 calories per da
    6·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Las flores son abioticas o bioticas​
    13·1 answer
  • What 6 elements make up all lifeforms on earth?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!