1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lbvjy [14]
2 years ago
12

Cancer cells require many nutrients, which are supplied by blood vessels. The growth of new blood vessels to cancerous tissue is

called:
Biology
1 answer:
prisoha [69]2 years ago
5 0
I think it’s angiogenic factors
You might be interested in
You have an unknown piece of matter in front of you that you believe to be a piece of bark from a tree. First, how would you det
natali 33 [55]

Answer:

<em>TO Determine whether Organic or not Just take some crystals on the end of a spatula and then introduce it in a flame, if it is melts or burns without white vapors then it is an inorganic compound and if you see white vapors or smoky vapors, it is organic. This is a very basic test which is used for this purpose.</em>

<em />

<em>idk the second  one..</em>

<em />

5 0
3 years ago
Heterotrophs obtain chemical energy from ______________.
loris [4]

Answer:

Heterotrophs obtain chemical energy for their survival by eating plants and animals.

Explanation:

  • The chemical energy that organism need comes from food. They break this food down to obtain energy.
  • Depending on their source of nutrients , they are classified into: Autotrophs and Heterotrophs.
  • Autotrophs use sunlight and photosynthesize to produce their own food. They are often known as producers.
  • Heterotrophs are beings that can't prepare their own food and consume other organisms to obtain energy.They are also called consumers.
  • Examples include: Animals, fungi,etc.
8 0
3 years ago
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
3 years ago
Which structure detects and helps to maintain body temperature
kirill [66]
It is hypothalamus B !!
7 0
3 years ago
An example of a vestigial structure is the
dangina [55]
I am pretty sure the answer is B human tailbone
4 0
4 years ago
Read 2 more answers
Other questions:
  • How is the DNA described and what does this mean?
    7·1 answer
  • What the similarities between mid ocean ridge and trenches?
    10·1 answer
  • Which is represented by the arrow labeled 1 in the diagram?
    10·1 answer
  • A geologist notices that the land on one side of a break in the crust is slightly higher than the other side. What has the geolo
    7·1 answer
  • How does different concentrations of solutes in a solution can affect organism's cells.
    8·1 answer
  • Which best describes the Earth’s inner core? A.hot and solid B.hot and liquid C.cool and solid D.cool and liquid
    14·2 answers
  • Why do scientists assign each organism a universally accepted name?
    6·1 answer
  • The pointer is indicating the virus's _____.
    10·1 answer
  • Dr. Flores would like an update on your research about what happened to the lake on Titan. Did the lake on Titan evaporate or fr
    11·1 answer
  • Which describes heritable<br> variation?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!