1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amid [387]
2 years ago
5

2. One of the physical characteristics is that a gas can

Biology
1 answer:
Strike441 [17]2 years ago
7 0
A. Gas can cause a lot of damage and that’s why you have to be careful around it
You might be interested in
If genetic drift is occurring you will be able to predict which allele will become more prevalent.
Blizzard [7]

Answer:

b. False

Explanation:

Genetic drift corresponds to a drastic casual alteration of the natural order, reaching the genotypic concentration of one or several species, not preliminarily involving natural selection factors, but caused by sudden events. As happens at random, it is impossible to predict which allele will be prevalent in a population suffering from genetic drift.

Such phenomenon is characterized by the occurrence of ecological catastrophes, for example: earthquakes, tsunamis, tornadoes, floods, burnings, avalanches and other processes, affecting a large population contingent.

Thus limiting the genetic content of a particular group, restricted to the prevailing individuals. It is up to them, integration into another population, if an adaptation is maintained, or over time, from geographic and later reproductive isolation, constitution of a new species (principle of the founding species).

In this situation, with low variability, differentiated individuals will experience a more significant selection pressure in relation to the ascending lineage, which minimized the achievements of selection due to the high number of living individuals.

During evolution, a hypothesis concerning the decimation of dinosaurs, which occurred around 66 million years ago, establishes not only the end of these animals, but of various life forms (including plants), due to a huge asteroid that would have reached planet, raising a dense cloud of dust resulting from the collision, compromising photosynthetic processes (dependent on solar energy), as well as the respiration and nutrition of organisms.

7 0
3 years ago
What is the summary of this section of we need batteries
mariarad [96]

Answer:

there is no attachment

Explanation:

8 0
3 years ago
Read 2 more answers
What happens when the density of a medium increases? A. Bending of light increases B. Bending of light decreases C. Temperature
Sholpan [36]
<span>B. Bending of light decreases
</span>According to the law of reflection, it stated that when light strikes the boundary between different media, a portion of the light is reflected while another portion enters the medium. Thus, the process in which the ray of light crosses the boundary and enters the second medium is known as refraction. However, the velocity of light decreases when light enters a denser medium.
7 0
3 years ago
Pizza restaurants often use large ovens lined with bricks. These ovens remain very hot, even though only a small fire is kept bu
tekilochka [14]
Density...
Fire bricks absorb many btu’s, so once heated up only a small flame is required to maintain that heat/temperature.

The fire brick composition is mostly materials like alumina silica sand, clay, not very porous.
5 0
3 years ago
Take three test-tubes. Fill each other with water. Label them A, B and C. Keep a snail in test-tube A, a water plant in test-tub
MaRussiya [10]

Answer:

Living organisms use oxygen and release CO2 during respiration.

Test tube A consists of snail which continuously uses the oxygen produced and releases carbon dioxide.

Hence, test tube A will have the highest concentration of carbon dioxide.

6 0
3 years ago
Other questions:
  • List the nine forms of energy that you learned about in this sec­ tion. explain why these are not the only possible categories o
    15·1 answer
  • Is the practice of genetically modifying human cells ethical? Why or why not?
    8·1 answer
  • Which of the following is not an accurate description of what science is
    6·1 answer
  • Which statement describes the biological molecule insulin?
    9·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • About how much time does a cell spend in mitosis?​
    12·1 answer
  • When a pathogen enters the body which blood component helps us attack the pathogen
    11·2 answers
  • The Kingdoms
    12·1 answer
  • Question 18
    15·2 answers
  • This nerve influences nearly every internal organ. Can it improve our mental state, too?.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!