1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dolphi86 [110]
2 years ago
6

I need help 30 pionts if u help me!!!!

Mathematics
1 answer:
enyata [817]2 years ago
4 0
If you want to find the volume have to multiply the length times width times height


As so 2 x 9.6 x 10= 192
You might be interested in
On a bicycle trail, the city is painting arrows like the one shown below:
Marina CMI [18]

Answer:

134

Step-by-step explanation:

1. seperate the rectangle bottom and the triangle top

2. I did the triangle first: 4×12=48÷2=24

3. the rectangle: 11×10=110

4. add the final numbers together: 110+24=134

7 0
3 years ago
Divide the difference between 70 and 20 by 25.
pentagon [3]

Answer:

The Answer is 2

Step-by-step explanation:

70 - 20= 50 and if you divide by 25 you get 2. Because 25 times 2 = 50 hope it helps

5 0
3 years ago
Read 2 more answers
The roots of a quadratic function are -2 and -6
PSYCHO15rus [73]

Step-by-step explanation:

The factors are x + 2 and x + 6.

5 0
3 years ago
Which expression can be used to find 12 percent of $98?
8090 [49]

Answer:

B

Step-by-step explanation:

12% is also known as 0.12 which we can multiply by $98 to get the answer.

(hope this helps)

3 0
3 years ago
What is the LCM of 70 and 36?​
Alik [6]

LCM = 1260

The lowest common factor is 1260

Hope this helps! :)

6 0
3 years ago
Read 2 more answers
Other questions:
  • Trevor solved the system of equations below. What mistake did he make in his work? 2x + y = 5 x − 2y = 10 y = 5 − 2x x − 2(5 − 2
    14·1 answer
  • Given: Circumscribed polygon ELPJ
    12·1 answer
  • In the diagram below, BD is parallel to XY. What is the value of y?
    13·2 answers
  • Find the greatest common factor of the<br> following monomials:<br> 2n 36n
    5·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • 15. Paul is scuba diving and is 3.5 feet below
    12·2 answers
  • which of the following inequalities matches the graph? graph of an inequality with a solid line through the points 0, negative 2
    6·1 answer
  • Michelle is four times as old as Fiona. Fiona is twice as old as Madeline. Madeline is seven years old. How old is Michelle?
    8·2 answers
  • 1.485 x 106 and 4.95 x 102
    15·1 answer
  • Please help me I am stuck
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!