1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NARA [144]
2 years ago
7

Which one of the amino acids is capable of forming a disulfide linkage with itself?.

Biology
1 answer:
Andrews [41]2 years ago
7 0

Answer:

Cysteine is the amino acid that is capable of forming a disulfide linkage within itself

You might be interested in
1. Which statement is NOT true?
Vladimir [108]

Answer:

c.Ionic bond is formed between two metals or two non metals.

5 0
3 years ago
Read 2 more answers
What is excretion meaning
lyudmila [28]

Answer:

excretion is the action of expelling waste from one's body.

Explanation:

7 0
3 years ago
Read 2 more answers
In this food pyramid, about __________ of the available energy is transferred to each level.
TiliK225 [7]

About 10 percent is transfered.

5 0
3 years ago
Read 2 more answers
Briefly describe how thyroid problem occurs in people.​
Misha Larkins [42]

Explanation:

Thyroid disease occurs when the thyroid (a small, butterfly-shaped gland in the front of your neck) does not produce the right amount of thyroid hormone. These hormones control how your body uses energy.

8 0
3 years ago
The term "semi-conservative" used to describe DNA replication means that: *
Nady [450]
Semi-conservative DNA replication means that one stand is new DNA and the other contains a newly synthesized strand.
3 0
3 years ago
Other questions:
  • What are some functions that are similar in both nerve cells and muscle cells?
    10·1 answer
  • When illness or injuries strike which of these issues may affect your finances?
    11·1 answer
  • In Pennsylvania, wolves have been extinct for many years. They used to feed on white-tailed deer, but not that the wolves are go
    13·1 answer
  • Ten-year-old Bill is playing with his baby sister, Lucy. He takes Lucy's teddy bear and hides it behind a pillow while Lucy watc
    9·1 answer
  • Which of the following is true about living species and extinct species?
    14·1 answer
  • Match the items.
    12·1 answer
  • Label the diagram with the parts of the respiratory system.​
    13·2 answers
  • Help it’s for a test if you don’t know pls don’t guess
    8·1 answer
  • DOES ANYONE WANNA TALK I'M BORED
    6·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!