1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katyanochek1 [597]
3 years ago
8

Specialized cells are grouped into structures known as?

Biology
2 answers:
FromTheMoon [43]3 years ago
7 0
Your answer is tissues! 

hichkok12 [17]3 years ago
6 0

Answer:

Tissues.

Explanation:

Tissues are the structures formed when some cells specialized to perform specific functions are grouped together. For example, the cells specialized to cover the body surface and line the cavities of internal organs together make the epithelial tissues. Likewise, the cells that are specialized to store the fat in the form of droplets from adipose tissues.

You might be interested in
The particles that make up matter always in what?
vampirchik [111]

Answer:

The Kinetic Theory of Matter

The states that all of the particles that make up matter are constantly in motion. As a result, all particles in matter have kinetic energy. The kinetic theory of matter helps explain the different states of matter—solid, liquid, and gas.

Explanation:

sdfghju7y6tredcvbnjmki8u7ytg

3 0
3 years ago
PLEASE HELP WHAT IS THIS BUG
Marysya12 [62]

Answer:

i dont know

Explanation:

5 0
3 years ago
Read 2 more answers
What are seismic waves?
Len [333]

Answer:

an elastic wave in the earth produced by an earthquake or other means.

Explanation:

earthquake, surface

primary wave

;)

4 0
3 years ago
Mushroom and yeast are members of the kingdom a) protists b) anomalía c) plantae d) fungi
barxatty [35]

D. Fungi

The kingdom Fungi includes a vast variety of organisms such as mushrooms, yeast, and mold.

8 0
3 years ago
How does fossilized carbon get back into the atmosphere? (2 poic) living organisms need nitrogen to build proteins and nucleic a
Anton [14]
<span><u>How does fossilized carbon get back into the atmosphere?</u>
</span>Fossilized carbon is coal. One major way it gets back into the atmosphere is by humans burning it in coal power plants. Carbon gets back into the atmosphere as carbon dioxide through the combustion of fossil fuels.

<span><span><u>How does a plant get nitrogen from the soil?</u>
</span></span>Plants take nitrogen from the soil<span> by absorption through their roots as amino acids, nitrate ions, nitrite ions, or ammonium ions.</span><span>

</span>
8 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Based on depth and distance from the shoreline,how many zones are found in ponds and lakes?
    15·2 answers
  • Which answer has the stages in the correct order for a humans life cycle
    6·2 answers
  • A food web is shown in the diagram below.
    8·2 answers
  • Drinking alcohol during pregnancy negatively impacts development of the fetus because: A: the mothers body is unable to process
    15·2 answers
  • In meiosis, one blank cell divides to make four blank cells
    7·1 answer
  • Changing one base in a gene could have the most direct effect on the ?
    14·1 answer
  • Which of the following is true about the efficiency of energy transfer in an ecosystem?
    6·2 answers
  • Which of the following is true about the mitochondrion of a cell?
    11·1 answer
  • If someone has both an x and y chromosome what gender at birth are they ?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!