1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
castortr0y [4]
2 years ago
12

Check the three factors that influence population growth. A. Increasing Longevity B. International Migration C. Fertility Rates

D. Social media use E. Water supply.
Biology
1 answer:
Aleksandr [31]2 years ago
3 0

Population growth is the increase in the population number of a given species in a time. Longevity, migration and fertility rates affect population growth.

<h3>What are the factors affecting population growth?</h3>

<u>Increased Longevity</u> has impacted the population growth as the life expectancy has resulted in the accumulation of more people as their age of living has increased.

<u>International Migration</u> can affect the population growth positively and negatively as moving of the person from one region will decrease its population growth while the region where they go will have increased population.

<u>Fertility Rates</u> has a great impact on the population as the fertility rate had decreased due to many factors and the population has declined.

Therefore, option A. longevity option B. migration and option C. fertility rates influence the population growth.

Learn more about population growth here:

brainly.com/question/12228859

You might be interested in
Which environmental change is not due to the overpopulation of humans?
BlackZzzverrR [31]
A an increase in global warming
8 0
3 years ago
Cell drinking of fluids by a unicellar organism is the process of
erica [24]
Each type of endocytosis involves encapsulating the target molecule in a pocket of cell membrane called a vesicle and bringing it to the lysosome so that it can be broken down. Pinocytosis (cell drinking), trapsliquids and any small molecules dissolved in the liquid
6 0
3 years ago
When organisms die, how does carbon re-enter the environment?
mel-nik [20]

Answer:

Forms sedimentary rocks

8 0
3 years ago
How does nutrient losses compare between the natural and clear-cut watersheds
fenix001 [56]

Answer:

A watershed is a region obtaining both land and water. This is a shallow land region which accumulates water from drainage obtain from different sources like lake, river and pond.  A watershed may also develop in a forest ecosystem. The clear cutting of forest will result expose more amount of soil nutrients for erosion by water as compared to natural forest. Therefore, nutrient loss will be higher in clear- cut watershed than natural forest watershed.

4 0
3 years ago
Read 2 more answers
What is the complementary strand for this segment of DNA? ​I'll give u 15 point pls answer
Fittoniya [83]
I think it’s TACGTTTAACGAGTGGCCCTAGTCGTGGCC
8 0
4 years ago
Other questions:
  • explain how changes in the epidermal cells of leaves help plants to conserve water during high temperature
    8·1 answer
  • Plsss give me examples
    15·1 answer
  • If a corn cell had 18 chromosomes would it be a gamete or somatic?
    10·1 answer
  • Use of a drug selection eliminates those stem cells with nonhomologous recombination products. Viral vectors, microinjection, T-
    12·1 answer
  • D) Name the subcellular structure involved in the translation of genetic material in protein synthesis​
    8·1 answer
  • Which organisms supply energy for all the others?
    10·2 answers
  • A negative tropism is when a plant grows towardaway from a stimulus.
    6·1 answer
  • Certain cells that line the stomach synthesize a digestive enzyme and secrete it into the stomach. This enzyme is a protein. Whi
    6·1 answer
  • which of the following works the same as a dynamo A . generator B.solar panel C.wind driven turbine D.torch battery​
    8·1 answer
  • 1. When I look at one of the organisms in the microscope, I notice a tiny nucleus
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!