1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Shtirlitz [24]
2 years ago
13

What does an ideal urchin environment would look like

Biology
1 answer:
Gwar [14]2 years ago
3 0
Despite their frequency in the intertidal zone, in tide pools, sea urchins can be found at many different depths and in any habitats. They can also be found in nearly any ocean temperature. Sea urchins inhabit the polar seas as well as the warm tropics.
You might be interested in
Euglenoid chloroplasts are surrounded by how many membranes
mixer [17]
<span>I think the answer is Three membranes. </span>
7 0
3 years ago
Read 2 more answers
Why are internal membranes important for eukaryotic cells?
Akimi4 [234]
They give it structure mostly. They also surround the organelles.
5 0
3 years ago
Read 2 more answers
5. A(n) ______, such as a salamander, is an organism that gains body heat primarily by absorbing it from the environment.
lawyer [7]

I believe the answer would be an Ectotherm

5 0
3 years ago
Into which layer of the uterus does the embryo implant
Maslowich
The embryo implants itself in the endometrium
7 0
3 years ago
Read 2 more answers
13sim15/4 the answer is (&lt;)
k0ka [10]
Don’t mind me getting my free points
4 0
3 years ago
Read 2 more answers
Other questions:
  • A water-soluble hormone approaches its target cell. Which will happen first? (2 points) The hormone's signal will be transduced
    13·1 answer
  • Examine the air pressure map. Which type of line is shown on the map?
    9·1 answer
  • How are pounds converted to newtons? Give an example.<br> can someone help me
    6·1 answer
  • Arrange the following steps that occur during drought tolerance in plants in a correct sequence.
    7·1 answer
  • please help me i have been asking this question on this website for a while now. What is Mancuso working on in his labs? Why is
    7·1 answer
  • Blood should not be stored in what way?
    14·1 answer
  • Which one of the following is a vitamin deficiency diseses<br>​
    8·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • How is the availability of needed natural resources affected by human activities?
    12·2 answers
  • I have a question what do these 5 cycles have in common (Water cycle, Carbon cycle, Oxygen cycle, Nitrogen cycle, Phosphorous cy
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!