1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Archy [21]
2 years ago
13

What is biological test​

Biology
1 answer:
il63 [147K]2 years ago
4 0

Answer: Biological Test Biological tests are frequently used to validate the physical and chemical tools or to provide complementary evidence about bioavailability process in a system. From: Chemosphere, 2017

Explanation:

Yw and pls mark ME AS THE BRIANIEST :D

You might be interested in
How are codominant alleles and incompletely dominant alleles similar how are they different?
KATRIN_1 [288]
Codominance is a form of dominance where alleles of a gene pair in heterozygous is completely expressed resulting to offsprings with a phenotype that is neither dominant or recessive. Incomplete dominance is a form of dominance in which one allele of a specific trait is not completely expressed over its paired allele resulting to a third phenotype in which the physical trait is a combination of the phenotypes of both alleles. Therefore, they are similar in that in both combine homozygous dominant and homozygous recessive. They are different in that in codominance shows both, heterozygous while incomplete dominance shows mixture or blend, new trait and heterozygous.
3 0
3 years ago
In an ecosystem, which is not a density-dependent limiting factor?
sertanlavr [38]
<span>D. Natural Disaster </span>
8 0
3 years ago
Read 2 more answers
The larynx, trachea, bronchi, and bronchioles all make up the
IRISSAK [1]

Answer:

Lower Respiratory Tract

Explanation:

The lower respiratory tract or lower airway is derived from the developing foregut and consists of the trachea, bronchi (primary, secondary and tertiary), bronchioles (including terminal and respiratory), and lungs (including alveoli). It also sometimes includes the larynx, which we have done here. This is where gas exchange actually takes place.

7 0
2 years ago
Which statement describes an innate behavioral adaptation of an animal?
shutvik [7]

Answer:

a pet parrot talking

Explanation:

dogs responding to "roll over"

6 0
3 years ago
What are compounds?<br> A. homogeneous mixture<br> B. heterogeneous mixture <br> C. pure substances
sammy [17]
C. pure substances
Hope this helps.
6 0
3 years ago
Read 2 more answers
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What are some of the dangers that volcanoes pose to human populations?
    7·1 answer
  • If you wanted to increase the rate of photosynthesis in a plant, you would develop a plant with which of the following character
    13·2 answers
  • Southern Italy is very close to the border of two tectonic plates. Which of these facts is most directly related to the closenes
    9·2 answers
  • Which of the following could have been components of membranes that covered pre-cells in ancient earth
    14·1 answer
  • Can someone help me ??
    12·1 answer
  • Bottleneck Effect (two examples)
    14·1 answer
  • Is it close to the end of the world
    12·2 answers
  • How do the properties of water and the ability to modify the rates of chemical reactions enable living things to carry out funct
    14·1 answer
  • Using the following diagram, which image shows the absorption of the highest energy photon?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!