1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
KatRina [158]
2 years ago
9

What is the change in heritable characteristics within a species over time?

Biology
1 answer:
Maru [420]2 years ago
6 0
Evolution is the change in heritable characteristics within a species ! :)
You might be interested in
Como se llama el presidente del estado unido
madreJ [45]

Answer:

Donald Trump es el jefe de Estado y de Gobierno de los Estados Unidos. Es el más alto cargo político del país por influencia y reconocimiento. El presidente lidera el poder ejecutivo del Gobierno federal.

El cual reside en la Casa Blanca, con una duración de cuatro años, con un máximo de dos mandatos; desde el 20 de enero de 2017.

Con un salario de $400,000 al año.

4 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
What is the complimentary strand to AGG-CTA_AAC
Virty [35]

Answer: The complementary strand is TCC- GAT - TTG

Explanation: During DNA replication, each strand of the DNA serves as a template for the synthesis of a new strand, thereby producing two new DNA molecules, each with one new strand and one old strand. A template is a DNA strand that would allow nucleotide molecules to be lined up in a specific order and be joined to create another DNA with a unique sequence. This results in creation of a double stranded DNA in which each strand is complementary to the other. In nucleotide base pairing, Guanine pairs with Cytosine while Thymine pairs with Adenine.

G = C while T = A.

6 0
3 years ago
What is a promoter? it's a region of dna that binds dna polymerase to begin replication. it's a protein that promotes transcript
Zinaida [17]
It's a region of DNA that binds DNA Polymerase to begin replication.
8 0
2 years ago
What are some activities that cells engage in that require energy? And from where do cells obtain the energy they need to make A
malfutka [58]
Some activities that cell requires energy may include cell division, active transport, protein synthesis etc.
In human, Cells get their energy by the food we eat. The nutrients in the food breaks down into soluble and simple molecules in stomach and small intestine and it is absorbed through the small intestine and assimilated into the cells, becoming part of it, providing the uses for each type of nutrient. And of course, many of them is the energy source.
8 0
3 years ago
Other questions:
  • Name two non-renewable energy sources?
    13·2 answers
  • ANSWER ASAP THANKS
    10·1 answer
  • Does carbonhydrates provide the most energy or kilocalories per gram of food ?
    7·2 answers
  • What is the relationship between cloud cover and the amount of energy that hits the Earth? a. increased cloud cover increases th
    6·2 answers
  • 1. Which of the following farm practices have been used by farmers only in recent years? a. fertilizing
    5·2 answers
  • The stretch hold is a restraint technique:
    9·1 answer
  • What is the difference between a recessive and a dominant trait
    14·2 answers
  • If a corn plant has a genotype SsTt what are the possible genetic combinations that could be present in a single grain of pollen
    7·1 answer
  • Can mutations be inherited by offspring
    11·2 answers
  • What is a photosynthesis?​
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!